pattern finding between sequences

How to find pattern between these sequences? That generated by regx -

GGGGGTGGAGG,GGCGGGGTGGGGG,GGCGGGGGGGG how to find GQSes between these sequences?

sequence

• 2,516 views • link

updated 10.2 years ago by GenoMax 16K • | written 10.2 years ago by srivvivek20 0

Please word your question better and give us more context. Please read item #3 on A: How do I ask a question on Biostars?

• 1 views • link

written 10.2 years ago by Ram 4.5K

You can use fuzznuc from EMBOSS.

• 1 views • link

written 10.2 years ago by GenoMax 16K

0 answers

No answers yet.

More posts like this

distance between chip peaks and individual TSS
written 2.9 years ago by Tejaswini 0

I have generated my peak data through chip sequencing data and I have individual transcription sites coordinates from RNA sequencing data. How to compare the …
generate all combinations of strings from regular expression in R
written 4.8 years ago by Chirag Parsania 203

Hi, I have a regular expreesion - `C|T|G,C|T,T,C,G,A,G,A|G,A|G|C,A|T|G|C` of sequence motif. How can I generate all possible strings out of that in R ? EDIT …
Clustal Omega on uniprot
written 5.0 years ago by kodo64 0

Hi, Iv got two alignments (two sets of alignments (A and B)) that I have generated using clustal omega on uniport. I have selected the …
how to determine the gene involved in antibiotic resistance?
written 8.5 years ago by sharmilla_487 0

My project is to test the antibiotic susceptibility of abscessus strains, and then use WGS to find for the genes that cause the resistance. Here …
How can I handle 5 different time series gene expression pattern for the yeast gene SAM3 to infer g…
written 9.1 years ago by Thomas.F.Hahn3 3

Hi I am trying to analyze the series GSE3431. Its title is "Logic of the yeast metabolic cycle". Its URL is https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE3431. I am trying …
DARTseq methods on mammals
written 9.5 years ago by Barby 2

Hi there, I need some suggestions about a methodology that I recently adopted. I have generated DARTseq data on wildebeest. This is to try and …
pattern finding between sequences
written 10.2 years ago by srivvivek20 0

I want to count the number of occurrences of GQSes. How to find a GQS pattern between sequences? like 3:1:1 (GGCGGGTGGGG),4:2:1 (GGGGAGGGAGGGGG),23:21:7 (GGAGGAGGGGGTGGAGGAGGGGGTGGAGGAGGAGGAGGAGGAGGAGGAGGGTGGGAGGAGGGGGTGGAGGG) Expression is …
Meaningful clusters in phylogenetic trees
written 10.4 years ago by n00bgenome 4

So I have generated a large fastA file where I took 2 protein domains from a protein sequence. To be clear, I had an initial …
Identify common genes and their respective DNA sequences
written 11.4 years ago by sam 0

Hello, I'm trying to use these files to find the common genes between the multiple genomes (belong to Bacteria) and extract their genomic sequences. Does …
How To Find A Pattern For Consensus Sequences Using Java?
written 13.5 years ago by abhishalovers 0

How to find a pattern for consensus sequences using java?