pattern finding between sequences
How to find pattern between these sequences? That generated by regx -
GGGGGTGGAGG,GGCGGGGTGGGGG,GGCGGGGGGGG how to find GQSes between these sequences?
sequence
• 2,499 views
•
link
updated
by
GenoMax
•
written
by
srivvivek20 •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
distance between chip peaks and individual TSS
written by Tejaswini •I have generated my peak data through chip sequencing data and I have individual transcription sites coordinates from RNA sequencing data. How to compare the …
-
generate all combinations of strings from regular expression in R
written by Chirag ParsaniaHi, I have a regular expreesion - `C|T|G,C|T,T,C,G,A,G,A|G,A|G|C,A|T|G|C` of sequence motif. How can I generate all possible strings out of that in R ? EDIT …
-
Clustal Omega on uniprot
written by kodo64 •Hi, Iv got two alignments (two sets of alignments (A and B)) that I have generated using clustal omega on uniport. I have selected the …
-
how to determine the gene involved in antibiotic resistance?
written by sharmilla_487 •My project is to test the antibiotic susceptibility of abscessus strains, and then use WGS to find for the genes that cause the resistance. Here …
-
How can I handle 5 different time series gene expression pattern for the yeast gene SAM3 to infer g…
written by Thomas.F.Hahn3 •Hi I am trying to analyze the series GSE3431. Its title is "Logic of the yeast metabolic cycle". Its URL is https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE3431. I am trying …
-
DARTseq methods on mammals
written by Barby •Hi there, I need some suggestions about a methodology that I recently adopted. I have generated DARTseq data on wildebeest. This is to try and …
-
pattern finding between sequences
written by srivvivek20 •I want to count the number of occurrences of GQSes. How to find a GQS pattern between sequences? like 3:1:1 (GGCGGGTGGGG),4:2:1 (GGGGAGGGAGGGGG),23:21:7 (GGAGGAGGGGGTGGAGGAGGGGGTGGAGGAGGAGGAGGAGGAGGAGGAGGGTGGGAGGAGGGGGTGGAGGG) Expression is …
-
Meaningful clusters in phylogenetic trees
written by n00bgenome •So I have generated a large fastA file where I took 2 protein domains from a protein sequence. To be clear, I had an initial …
-
Identify common genes and their respective DNA sequences
written by sam •Hello, I'm trying to use these files to find the common genes between the multiple genomes (belong to Bacteria) and extract their genomic sequences. Does …
-
How To Find A Pattern For Consensus Sequences Using Java?
written by abhishalovers •How to find a pattern for consensus sequences using java?
Please word your question better and give us more context. Please read item #3 on A: How do I ask a question on Biostars?
You can use fuzznuc from EMBOSS.
See also this site, it may be helpful.
http://www.bioinformatics.org/sms2/dna_pattern.html
But you have to ask for a particular pattern.
What does GQS stand for? It's a new term for me :)
G-quadruplex forming sequences (GQS).