Hello.
I'm wondering if there is any way to determine if the frequency of a specific k-mer (inside a specific length sequence) is significant statistically.
For example, let's say that we have the following sequence:
ATAGATCATAGATAGATGGAGTTACT
the 5-mer ATAGA has a frequency of value 3.
1) How can we determine which is the probability of this 5-mer to be appeared 3 times in that specific sequence ? 2) Is this probability statistically significant ? Could this probability, probable means something ?
I'm not looking for ready R libraries that might be possible to calculate these but for mathematical/statistic models/ideas to approach it.
Thank you
•
written
by
arronar
1 answer
I've started writing some explanation, but everything has been already done.
See this post:
Log in to answer this question.
-
Setting Thresholds and Interpreting Results in GWAS
written by CaERu _no_ korokoro •
-
How can validate hub genes or significant factors using area under the ROC curve (AUC)?
written by wyt1995 •
-
protein K-mer connection
written by kartik.aier.gta •
-
Calculation of 2 sided p value from Monte Carlo simulation with frequency parameters?
written by hs.lansdell •
-
Add more info to d3heatmap cell notes fetched from other columns.
written by arronar
-
Probability of finding a common sub-sequence of at least 'k' nucleotides between two sequences.
written by Carlo Yague
-
Quantile normalization and variability questions
written by arronar
-
Tutorial: Rembrandt Glioma Data Analysis (PART II) - Are Gender specific genes related to cancer ?
written by majuang66
-
How to calculate overall coverage in de novo metagenomics assembly?
written by scchess
-
Conditional Probability Model for a Bacterial Species/Genus
written by anthony.gough •
