This is a test version of Biostars. For the public version, visit https://www.biostars.org.
From Single Line To Fasta Format ?

Hi, I'm parsing some sequences and I need to transform them from a single line to fasta format... The format I have now is something like this:

Name_of_the_specie AGTAGAGATTGAGATGAGGAGATTCCCATAGAGTTCGAATAGCTGTAATAGAG
Name_of_the_specie2 AGGAGGTTTGAGAGTTTTGAGAGGTGGGGAGAGTTTTTTAAAGGGGGAAAGAAGGAGAATGAGAGGGTTGAG  
Name_of_the_ specie_3 ACATGCGATGAGGGCCCTTTATAATTTAATTGCGCTAAATAGATCTCCCTTTAGGGATATTGAGGAAGAGGAGGGATTAGGAGATTAGAGAGATAT

and so on... (>300)

I want to make a single file containing all those sequences in fasta format, if possible using perl/awk/sed.

Thanks!

fasta parsing perl awk
• 7,344 views • link
updated by Lucy • Lucy • written by Carla • Carla

4 answers

Assuming the name of the file doesn't have spaces, neither does the sequence and the new sequence starts in a new line - this should be straightforward

awk '{print ">"$1 "n" $2}' file_name > new_filename

the command would print > before the name ($1) and after a new line "n" you would get the sequence ($2) - which would be the fasta format 

>Name_of_the_specie 
AGTAGAGATTGAGATGAGGAGATTCCCATAGAGTTCGAATAGCTGTAATAGAG 
>Name_of_the_specie2 
AGGAGGTTTGAGAGTTTTGAGAGGTGGGGAGAGTTTTTTAAAGGGGGAAAGAAGGAGAATGAGAGGGTTGAG
>Name_of_the_ specie_3 
ACATGCGATGAGGGCCCTTTATAATTTAATTGCGCTAAATAGATCTCCCT TTAGGGATATTGAGGAAGAGGAGGGATTAGGAGATTAGAGAGATAT
• 1 views • link
written by ngsgene ngsgene

thank you, I was trying to do it in awk and I was doing it wrong... now I know for the next time !

• 0 views • link
written by Lucy • Lucy

If it is one line per name and sequence, you can use this command:

perl -ane 'print ">$F[o]\n$F[1]\n";' yourFile.txt > yourFile.fasta
• 0 views • link
written by David Langenberger David Langenberger

many thanks! :)

• 0 views • link
written by Lucy • Lucy

If your file is really as simple as you say then just do:

sed 's/^/>/' file1 >file2
sed 's/ /\n/' file2 >file3.fasta
• 0 views • link
written by Daniel Daniel

as long as there are no spaces in your species name...

• 0 views • link
written by Daniel Daniel

thanks! yes, I didn't have spaces in the names :)

• 0 views • link
written by Lucy • Lucy

You can do it in one line and avoid that intermediate file: sed -e 's/^/>/' -e 's/\ /\n/' inputfile > outputfile

• 0 views • link
written by Frédéric Mahé Frédéric Mahé

Mabeuf,David and ngsgene, many thanks!

All the solutions work perfectly! :)

• 0 views • link
updated by Neilfws Neilfws • written by Lucy • Lucy

Use comments for replies please, not answers.

• 0 views • link
written by Neilfws Neilfws

Log in to answer this question.

More posts like this
  • Why Perl Or Sed Command Not Working
    written by biolab biolab
    <p>Hi everyone I have a fasta file like below.</p> <pre><code>&gt;miR156a GACAGAA &gt;miR156b GACAGAA &gt;miR156c GACAGAA ............ </code></pre> <p>I need to format it as below.</p> <pre><code> …
  • How To Modify Contig Format:
    written by HG HG
    <p>Hi everyone I need co change a contig file format : can any one help me out using awk or perl </p> <p>Input file:</p> <pre><code>&gt;NODE_411_length_76_cov_325.381_ID_5152754 …
  • How To Edit Contig Format??
    written by HG HG
    <p>Hi I have some contig like that :</p> <pre><code> &gt;NODE_1_length_262931_cov_39.3702_ID_6774944 GACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGT GAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTG ACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCAC CTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGTAAGGAAGGGGCAACA &gt;NODE_2_length_249731_cov_38.5539_ID_6775452 TGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGC TGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCA TTACCAACATCGTGAAAGAAATCCACAATAATGATCTTAAGCAGCAATTGATGAGTGAAT ..................................................................................................................... </code></pre> <p>I Need like this each …
  • Fastq Convert To Fasta
    written by biolab biolab
    <p>Dear All, Am I right to use the following script to transform a fastq file (named test.fastq) to a fasta file? THANKS a lot!</p> <pre><code>#!/usr/bin/perl …
  • Help Needed For Extract Sequence Information From A Database
    written by redspider19800915 • redspider19800915
    <p>Help needed for a simple question: <br /> I have a local database containing millions of sequences in fast format as follows: </p> <pre><code>&gt;leaf_1 AAGACCATTCGAGCTTATCTCTTC …
  • How To Merge Fasta Header With Description Using Perl :
    written by Torque_Cloud • Torque_Cloud
    <p>I have a fasta file that contains sequences like so :</p> <pre><code>&gt;PT_TAC_1 ATGCATGCATGC &gt;PT_TAC_2 ATGCATCGATCG </code></pre> <p>Following BLASTx, i obtained blast results in tabular format. …
  • How To Pull Out Qual From Multi Line Fastq?
    written by Zhshqzyc • Zhshqzyc
    <p>From <a href="http://biostar.stackexchange.com/questions/1389/how-to-generate-a-consensus-fasta-sequence-from-sam-tools-pileup">http://biostar.stackexchange.com/questions/1389/how-to-generate-a-consensus-fasta-sequence-from-sam-tools-pileup</a> We use awk and perl to get fasta by</p> <pre><code>awk '/^@chr1$/,/^+$/' consensus.fastq | perl -pe "s/@/&gt;/ ; s/\\+//" &gt; chr1.fasta </code></pre> <p>The …
  • Help With Counting Script
    written by Confused • Confused
    <p>I am very new to bioperl and am trying to write a script that counts the number of sequences, number of characters, %GC content and …
  • Fasta Format Sequence Parsing With Bioperl
    written by Raghul Raghul
    <p>Hi I am having a fasta format sequence but the header line is not like NCBI description(please see below). </p> <pre><code>&gt;contig07303 length=480 numreads=24 gene=isogroup00008 status=isotig …
  • Perl How To Isolate Fasta Sequences With A Specific Keyword
    written by Raghul Raghul
    <p>HI to all, I have a file with lots of sequences but I want to extract sequences only with the keyword "FULL-LENGTH". I dont want …