This is a test version of Biostars. For the public version, visit https://www.biostars.org.
conditional expression in sed ...?

Hi,

I have a file looking like this

@HISEQ:229:C81CCANXX:1:1101:10157:17161/1
AAAAAAAAAAAAAAAAAAAA
+
CCCCCGGGG/1GGGGGGCEEG
@HISEQ:229:C81CCANXX:1:1101:10741:22239/1
GCCTTGCTATTGACTCTACT
+
BBBB@EEGGGGGDGGEGGGG
@HISEQ:229:C81CCANXX:1:1101:10901:88419/1
GCTTAGGGATTTTATTGGTA

I would like to remove this /1 at the end of the lines (read names).

I did

sed -i -e 's/\/1//g' MyFile.txt

But the problem is that is also removes the /1 occurring in the middle of the 4th line (sequence quality).

Is there a way to substitute the /1 only on lines starting with @HISEQ (a sort of conditional expression) ?

I also tried:

awk -F "/" '/^@HISEQ/{ $2 = "" ; print $0 }' essai.change.name> file.txt

The problem then is that I have only the @HISEQ lines and I loose the lines in between.

Thank you!

C. Anna

sequence

Avoid the -i flag on sed if you are not sure what you are doing, better would be to just pipe the result to e.g. head to check if the command performed as you thought.

1 answer

'$' for end of the line:

sed 's%/1$%%'

Is there a way to substitute the /1 only on lines starting with @HISEQ

sed '/^@HISEQ/s%/1$%%'

Does it work with GNU sed? (No change in result when I tried)

I did the following

sed '/^@HISEQ/s/\/1//' in.fq
$ echo -e "@HISEQa\1\nx\1" | sed '/^@HISEQ/s/\\1//'
@HISEQa
x\1

$ sed --version
sed (GNU sed) 4.2.2

This one

sed '/^@HISEQ/s%/1$%%'

worked perfectly! Thank you

I would like to make sure I understand the syntax though.

It says: for the lines starting with @HISEQ (^@HISEQ), delete (s%), the character "1" (1$%%). Is this right ?

I'm not sure to understand the function of the %%

Log in to answer this question.