This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Perl Help to find orf

Create a new subroutine that accepts a reference to an array containing multiple sequences and returns the first reading frame for each sequence

perl orf
• 2,352 views • link
updated by Ram Ram • written by ksi216 • ksi216

Hello ksi216!

We believe that this post does not fit the main topic of this site.

This sounds like literal copy paste of homework, what have you tried?

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

• 1 views • link
written by Michael Dondrup Michael Dondrup

It is a homework assignment, but I'm having trouble. I'm a bioinformatics student. This is what I tried

use strict;
use warnings;

sub revcomp{
    my($DNAin) = @_;
    my($DNAout) = reverse($DNAin);
    $DNAout =~ tr/ACGT/TGCA/;
    return $DNAout;

    my $DNA= "CCTCACACGCCCTGTTCTGGTGTCTGGTCGGATGTGTTGGTCGTGCGCAGATTGGTGCTC"; #declare scalar for seq
    my $rcDNA=recvomp($DNA);
    print "rcDNA\n";
}
• 1 views • link
updated by Ram Ram • written by ksi216 • ksi216

This looks like code from your previous assignment but is unrelated to the new assignment, you haven't even created a new subroutine. Unfortunately this format is not really suitable to teach programming from scratch, and I don't want to do your homework completely. I think you have to try harder here, means post some code that is at least close to what is asked for. Hint: what is an "(open) reading frame", does it need to be translated at all? How do you declare a subroutine?

• 1 views • link
written by Michael Dondrup Michael Dondrup

0 answers

No answers yet.

Log in to answer this question.

More posts like this