This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Issue in running viroBlast from localhost

I have an issue in running viroBlast from my localhost. It is stand-alone BLAST web server that can be installed in your localhost. When I run it from the above link, the result comes in less than one minutes. But when I run it from my localhost "after install it", it takes "days" showing:

Your job is being processed
Your job id is .......
Please wait here to watch the progress of your job.
This page will update itself automatically until search is done.

and nothing happened except showing this msg and increase the time. Could anyone test it please? It just takes few minutes for installing from here.

Thanks,

blast php viroblast javascript sequence

How many sequences are you trying to blast?

I don't know! The database is come with the distributed directory.

I was referring to the number of sequences in your query (input fasta).

It just:

ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA

Why not just use the NCBI website? Blasting against nt gives me a perfect hit to human cortistatin, filtering for viruses in nt by taxid gives me a very, very poor hit to Papiine herpesvirus 2.

Are you sure you even have a viral sequence?

I am working on develop web-based blast page so, I need the source code which viroBlast provide it. I hope that I can use NCBI C++ toolkit but, it designed for cmd application only. However, the problem is solved now.

Thank you.

You're not really developing anything if you just lift code from another application...

I am not developing it from the scratch. I am just try to integrate it with other application and do some modification.

Stupid question, but have you installed blast, ViroBlast is not much more than a web-form and CGI script calling blast. "4. All bug reports and technical questions shall be sent to Dr. James Mullins, email: jmullins@u.washington.edu."

Did you send an email to him?

On a side note: So here you have agreed to a license that tries to get control over how you communicate, namely who you have to / shall (this doesn't really have any consequence though) send emails to. We had looked at ViroBlast, too, however the license terms put me completely off.

I have the same issue with you, when I was running viroBlast for Linux.Could you help me please? Thanks.

0 answers

No answers yet.

Log in to answer this question.