Previously I have been using FastQC to identify overrepresented sequences (adapters) to feed cutadapt tool for trimming.
Right now I have about 50 bam files (sequenced by Illumina) that need quality control including removing adapter seq, but I cannot go through FastQC individually to identify each "unique" adapters.
That said, I am wondering if it's possible to preload a long list of all known Illumina adapters into cutadapt? If so is there a simple text file that holds these adapters? If this is not the best method I am open to alternative solutions. Thank you guys for your help.
•
written
by
umn_bist •
Thank you for your reply. Is there a place to download a fasta file of all illumine adapters in RNA seq samples? I had previously been to that link but I am curious if a special format is necessary to build a custom fasta. If not, which libraries are considered relevant for RNA samples? Thanks again.
PDF seems like the dumbest format ever for a list of primers. Has anyone come across this table in Excel, tsv or some other format that makes sense?
You have to use the -a parameter in cutadapt: http://cutadapt.readthedocs.org/en/stable/guide.html#removing-adapters
-a AdaptorList.fasta
Thank you for your reply. Does the fasta file for adapter list require a special format? Is it as simple as creating a txt file with a list of all adapters and changing the file extension to fasta? I can only guess cutadapt or any clippers won't know how to differentiate a 3' adapter from a 5' adapter. Which Illumina libraries are considered relevant for RNA samples? The samples were retrieved from CGHub (unaligned) so I don't know which Illumina version these samples used. From the link posted above I found TruSeq, TruSeq short, and Oligonucleotide Sequences for the v1 and v1.5 Small RNA Kits. Thanks again.
•
written
by
umn_bist •
Does the fasta file for adapter list require a special format?
strange question ... it requires FASTA format.
>TruSeq Adapter, Index 11
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
If you don't know which adaptors have been used, you put all in the fasta file. It should work fine. For differentiation between 3' and 5' adapters, I don't know...
Log in to answer this question.
