Can we use the index file created for Bowtie on BWA alignment?

Hi All,

It's due to a curiosity, Can we use the index files created by Bowtie can be used for BWA for mapping? I am new to the genomics field, Please do consider as a noob question.

Thank you.
Amk

bwa bowtie index

• 2,697 views • link

updated 10.6 years ago by Devon Ryan

• written 10.6 years ago by Amk

1 answer

No, they have different formats.

• 0 views • link

written 10.6 years ago by Devon Ryan

Thank you Devon

• 0 views • link

written 10.6 years ago by Amk

More posts like this

mirDeep2 mapping error
written 7.7 years ago by nivya.james2016 •

Hi all, Kindly help me with this issue shanthi@shanthi-client2:~/Desktop/Nivya/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p genome -s reads_collapsed.fa -t …
Tophat syntax to align query sequences to reference index
written 10.3 years ago by marongiu.luigi

Dear all, I need to align some fastq files to the human genome. I prepared the reference index files and transcriptomes with bowtie and tophat …
Agilent SureSelect design miss some target regions
written 10.5 years ago by Amk

Dear All, I am designing probes using SureSelect DNA for targeted sequencing of a particular gene. But after designing using default settings …
Any web server for KOG annotation for denovo transcriptome assembly?
written 10.6 years ago by Amk

Dear All, Is there any web server or tool for doing the KOG annotation for a denovo assembled transcriptome data. I am …
Is it true that N50 is not an important parameter for quality in Transcriptome Assembly?
written 10.6 years ago by Amk

Dear All, I came to know that N50 value is not an important parameter to determine the Assembly quality in Transcriptome assembly …
What Analysis after Denovo Assembly of RNA-seq of a species?
written 10.7 years ago by Amk

Dear All, What all analysis we can do after the Denovo assembly for Transcriptome sequencing data of a new species. As the transcriptome data is …
Can we draw phylogenetic tree using a set of Kegg Orthology Terms ?
written 10.7 years ago by Amk

Dear All, I have done pathway annotation report with Kegg Orthology IDs for my species of interest. Can I draw a phylogeny …
Plotting bar graph with contigs from assembly in zebrafish chromosome?
written 10.7 years ago by Amk

Dear All, I am new to genomics. Kindly forgive if this question doesn't make sense. I have thousands of contigs from an assembly. I came …
Is there any databases preloaded with GO annotations for each species?
written 10.7 years ago by Amk

Hi all, We all know different ways to annotate the genes with GO terms. My question is that if I want to compare GO terms …
R1 R2 orientation (RNA-seq)
written 12.1 years ago by biotech

Hi, Will always R2 file contain sense transcript and R1 reverse complement of transcript? If R2 file contains sense transcript, I will have to run …