inversion detection in sequencing

I am working on detection of sequence variations and have one question what should be the best way (tool) to detect Inversion in DNA-seq.

Thanks

invesrion sequencing

• 2,409 views • link

updated 10.6 years ago by Zev.Kronenberg

• written 10.6 years ago by kanwarjag

1 answer

There are many tools that can detect inversions:

Delly

Lumpy

Wham

...

• 0 views • link

written 10.6 years ago by Zev.Kronenberg

You probably mean Lumpy? Or is there a Lumy as well?

• 0 views • link

written 10.4 years ago by h.mon

More posts like this

How to exclude reads with five or more variations from the reference
written 6.4 years ago by Gene •

I am working on SNP analysis. Sequencing was performed by Molecular Inversion Probe (MIP)-based re-sequencing. I have BAM files right now, and I am trying …
aneuploidy detection in DNA sequencing
written 9.5 years ago by joerodger2017 •

I am planning to perform DNA seq for detection of aneluploidy condition in circulatory DNA. Is there a set rule how much sequencing depth should …
Adapter trimming in basespace
written 10.2 years ago by kanwarjag

I have used NuGEN RNA-seq kit and adapter sequence. is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (TruSeq Universal Adapter) However in base space (FASTqToolkit) closest one is True seq dual …
representation of chipseq and RNA-seq data
written 11.6 years ago by kanwarjag

I have a two data sets related to same biological experiment (asking same question from different scientific perspective) In RNA-seq I can easily show expression …
How To Process Data From Bisulfite Sequencing Of An Exome
written 12.5 years ago by kanwarjag

I have an exome sequencing data and wonder what should be the best way to process these file for bisulfite seq. I believe I can …
Rna Seq On Unannotated Genome
written 13.1 years ago by kanwarjag

I have a RNA seq data which is from a an unannotated eukaryotic species. The reference genome is available but is not annotated. What should …
Motif And Down Stream Analysis
written 13.1 years ago by kanwarjag

This question is taking bioinformatics analysis to down stream analysis. I have identified 3 Chipseq motifs (obviously I ran chipseq called peaks and identified …
Detecting Rearranged Reads From Sam/Bam File
written 13.4 years ago by Tomáš Beluský •

Hi, how can I detect rearranged reads from SAM flags? I thought left read should have set 0x40 (first in pair) and right read 0x80 …
How To Design A Long Noncoding Rna Detection And Quantification Experiment
written 13.4 years ago by kanwarjag

I am planning on an experiment for detection of novel linnoncoding RNA as well as expression of known lincRNA in patient samples. I was wondering …
Snp Detection In Polyploids Via Clc Genomics Workbench
written 14.0 years ago by pjyoti29 •

Hello everyone, I am working on solid sequence data. I am using CLC Genomics Workbench for mapping and snp detection. I wanted to know what …