rosalind.info not working?

Does anyone know the reason why the site www.rosalind.info not working for 6 hours?

It keeps saying

500 - Bad Code

GACCCAGCAATGACGTATACAGGGCTTAAT CTGGGTCGTTACCGCATATGTACCGAATTA

We'll patch this code soon. Please try again later or compile another code.

rosalind

• 2,766 views • link

updated 4.0 years ago by Ram

• written 10.7 years ago by kenneth.jh.han •

3 answers

The site is down - You'll just have to wait for it to come back up or contact the maintains on twitter, or another social media platform.

• 0 views • link

updated 6.7 years ago by Ram

• written 10.7 years ago by andrew.j.skelton73

I got an email yesterday that they have a new edition of the associated textbook coming out, so maybe they're updating the site to reflect that new content? It didn't mention any planned downtime though.

• 0 views • link

written 10.7 years ago by 13en

Site appears to be back up as of now.

• 0 views • link

written 10.7 years ago by GenoMax

More posts like this

bam is in a format that cannot be usefully indexed
written 2.1 years ago by Kelly •

Hi everyone, I am new to coding and am attempting to create .BAM files from my fastq trims, but it is giving me the error …
Can´t acces Biomart via R anymore
written 3.6 years ago by Beginner •

Hi, my R code previously accessed Biomart via: library("biomaRt") mart=useMart(biomart="ENSEMBL_MART_ENSEMBL", dataset="mmusculus_gene_ensembl", host="www.ensembl.org") resMArt=getBM(attributes=c("ensembl_gene_id","description","mgi_symbol"),mart=mart) resMArt2=getBM(attributes=c("ensembl_gene_id","gene_biotype"),mart=mart) however, mart=useMart(biomart="ENSEMBL_MART_ENSEMBL", dataset="mmusculus_gene_ensembl", host="www.ensembl.org") now gives the error: Error in listMarts(host …
Weird output of DESeq2 when using single one sample from one group agains the other group (6 sample…
written 4.5 years ago by FantasticAI •

Hi I'm currently working on RNA-seq analysis, and my goal is to get differentially expressed genes using DESeq2. I have 2 groups, A and B, …
makeblastdb won't run in terminal (Mac OS X)
written 8.2 years ago by alexille5640 •

So I downloaded the BLAST+ executables from NCBI (from here: ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/). I opened terminal, copied and pasted the path to where I unzipped the BLAST+ …
CWL: Linker error doing 'pip install cwlref-runner' on CentOS 6 system
written 9.2 years ago by Kevin Ernst •

I get the following linker error trying to `pip install cwel-runner` on a CentOS 6 system, within a virtualenv using `python27-python` from the "centos-sclo-rh" repository: …
Forum: Good Habit for Bioinformatics Analyst or Scientist
written 10.3 years ago by Shicheng Guo

Hey colleagues, Summary some good habit in our research. I have been hit by the project badly since some bad habit, such as: 1. Record …
biomaRt duplicates some unique IDs during getSequence() query but not others
written 11.4 years ago by eromasko

Hello to everyone. After reading through the biomaRt Reference and Users guides, I have a question I'm hoping someone here can help with. I am …
Split a bam file per read
written 11.8 years ago by s.vdrzeeuw •

So I have a full genome PACbio BAM file and this has a average coverage of 3-6. Now I want to split the bam file …
Perl Script Dies When Processing Large Datafiles. Is It A Perl Buffering Issue?
written 13.4 years ago by dannyjmh •

<p> Hey everyone! I think i'm having a buffering issue since i need to read and parse big text files (created by myself in previous …
Normalizing Count Data In Rna-Seq
written 14.2 years ago by Arun

<p>Hello, Suppose I have RNA-seq data for 1) control, say, <code>T0</code> 2) treatment after 4 hours <code>T4</code> 3) treatment after 8 hours <code>T8</code> and I …