Non A T G C base in RefSeq zebrafish mRNA sequence

I found some non A T C G base in refseq zebrafish mRNA sequence: 'Y', 'K', 'R', 'M', 'W'

Couldn't find out what do they mean.

e.g.

NM_001012366.1
http://www.ncbi.nlm.nih.gov/nuccore/59933235?report=fasta
at line:
CCCCCACAGTCCCTGCATTACGGGAATGTGCAGGCAAGAGGAAGCGGTCTCAGGGAGAGGAGGMCGAAGG

This is causing error for some alignment tool, such as bfast.

Thanks

rna-seq sequence

• 2,313 views • link

updated 4.0 years ago by Ram

• written 10.7 years ago by xiangwulu •

2 answers

Could be IUPAC codes for ambiguous nucleotides: http://droog.gs.washington.edu/parc/images/iupac.html

• 0 views • link

updated 6.7 years ago by Ram

• written 10.7 years ago by Lemire

Yes it is IUPAC. If they crash the tool you use, just mask them (replace them by N)

• 0 views • link

written 10.7 years ago by Juke34

More posts like this

rRNA contamination after filtering
written 1.8 years ago by sleepystudent •

Hi everyone ! I am re-analyzing a dataset from [GEO][1]. I have noticed that there was a strange GC in some samples, and after pseudo-counting …
mRNA Translation: TGG/UGG as a start codon?
written 5.6 years ago by rebelCoder •

Hello everyone! I have written a very simple code to generate `Proteins` from `DNA/RNA` by generating 6 reading frames and matching all 6 against the …
Extracting only reads mapped to specific genomic region
written 5.7 years ago by agata •

I have a specific genomic region saved as `fasta`. I want to check how many reads mapped to this specific region and extract them, as …
rentrez::entrez_fetch and web API returning empty FASTA records (R)
written 6.3 years ago by alopex •

Hi all, I've been using `entrez_fetch` in R package `rentrez` v1.2.2 to extract nucleotide sequences in FASTA format for a large number of GIDs. For …
Remove ambiguous calls in the VCF file
written 7.9 years ago by SOHAIL

Hi everyone, I have a VCF file with multiple ambiguous ref/alt calls at some positions of the genome with ref allele type Y, R, M, …
generate consensus sequence from unphased heterozygous calls
written 9.9 years ago by atul_shah1 •

I'd like to generate a single consensus by substituting a set of unphased snp and indel variant calls, each with specified zygosity, into a reference …
Fasta file substitution
written 10.7 years ago by max1415r •

I have a batch protein FASTA file. I wan to create output file with position for each amino acid with possible mutation (remaining 19 aa) …
search/subset multiple sequence alignment for all columns with specific ambiguity base (linux or se…
written 11.5 years ago by jal •

I have a multiple sequence alignment generated by MAFFT. I know there are some positions where one or more sequences have an ambiguity base other …
What Is A Good Way To Implement Getting A Consensus Sequence In Java?
written 14.6 years ago by Brandstaetter

I have the following problem: <ul> <li>I have 2 Strings of DNA Sequences (consisting of ACGT), which differ in one or two spots.</li> <li>Finding the …
Mapping To Genome With Ambiguous Reference Characters (R,Y,K,M,S,W Etc.)
written 15.7 years ago by Rm

I am mapping illumina reads using bowtie/bwa to a reference genome with ambiguous reference characters (N, -, R, Y,K,M,S,W etc.). For example: At a …