Hi guys,

I used Bowtie to align CLIP-seq reads to genome with the parameter -v 1 which allow the reads have one mismatch. But in the result, Bowtie treat all the nucleotides of reads as insertion. For example:

2-42    16      chr11   86397621        255     23M     *       0       0       GTCAACATCAGTCTGATAAGCTA IIIIIIIIIIIIIIIIIIIIIII XA:i:0  MD:Z:23 NM:i:0

Does any one have any idea what happened? What should I do to make it work?

Thanks,
Yue