This is a test version of Biostars. For the public version, visit https://www.biostars.org.
All the CIGAR strings of reads mapped by Bowtie are "I"

Hi guys,

I used Bowtie to align CLIP-seq reads to genome with the parameter -v 1 which allow the reads have one mismatch. But in the result, Bowtie treat all the nucleotides of reads as insertion. For example:

2-42    16      chr11   86397621        255     23M     *       0       0       GTCAACATCAGTCTGATAAGCTA IIIIIIIIIIIIIIIIIIIIIII XA:i:0  MD:Z:23 NM:i:0

Does any one have any idea what happened? What should I do to make it work?

Thanks,
Yue

bowtie

1 answer

IIIIIIIIIIIIIIIIIIIIIII is not insertions. It's the quality values of each base. 23M is the CIGAR string.

I'm sorry...but the original sequence is TAGCTTATCAGACTGATGTTGAC, how does it match the sequence in the result?

It mapped to reverse strand. So its reverse compliment. The flag 16 indicates that.

oh...I see, Thanks!

Log in to answer this question.