This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Converting tags to gene names in GPL9115

I have downloaded GSE31617 data. As you can see its platform is GPL9115.

In mRNA files, there are three columns:

       Tag                            CopyNumber    TPM(Transcript Per Million)
CATGTGGATGGGCTTCTTGTA                    2                          0.23
CATGGGGCCTTCCAGACCCAC                    2                          0.23
CATGTGCATTTTCAAGTGGGT                    2                          0.23
CATGAGCCACCGCGCCCTGTC                    2                          0.23
CATGGAACTAATTCGCTGACC                    2                          0.23
CATGCTGCTTCGGCCCCAGCG                    2                          0.23
CATGGTCCTCACCCAAGCCTA                    2                          0.23
CATGTCTGTGTGTGGTGAGCA                    2                          0.23

How can I map Tag to RefSeq ID or gene symbol? My goal is making a matrix of expression profile.

Unfortunately, I did not find any useful information in GPL9115. SOFT formatted family file(s) in this page contains something like above columns for all of the available samples in GEO.

I appreciated it if anyone could help me.

rna-seq chip-seq gpl9115 refseq-id
• 2,294 views • link
updated by Ram Ram • written by Na Sed Na Sed

1 answer

You did not read http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM785379 ?

You should align the short tags to the genome using a (very) short read aligner, then overlap the alignments with the genome annotation as in a standard RNA-seq pipeline.

• 0 views • link
updated by Ram Ram • written by Michael Dondrup Michael Dondrup

Thanks for your help.

• 0 views • link
written by Na Sed Na Sed

Log in to answer this question.

More posts like this