This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Chipseq Fastq Files

Hi,

I have a raw sequencing file from illumina like below. This is chipseq data.

HWUSI-EAS491_2:1:1:1696:1814:ATTGCCGGACGCCAAGCTAGCCCGTGGGTGGGGGGG:hhS@EB?IEDBGA?>GE?B?CBBQ=CEG?FE@B?EN
HWUSI-EAS491_2:1:1:1369:1245:ATTGACAGTTGGCTCGCCAAATAGGAGGGCCGGCAG:hhhLIVOhAGIcD?ER@\F?DB??IDDMPFDHPF>G
HWUSI-EAS491_2:1:1:1572:1204:ATTTTGCGATGGCGGAAATTCTTGAGTTTAGTTGAT:hIC@GLBSHCOZ@FB?HCBADA@CA=B@@?FB?=C?
HWUSI-EAS491_2:1:1:1514:1273:AGAATAGCGGGGAGTTAAACGGTGCGGGCCAGGATC:hI[E??NN?]GPDE?>I?A?@>DC@DFDEB?DGA?C
HWUSI-EAS491_2:1:1:343:824:GATTAGAATCAGCCGTCGCTCGTTGTCCAGCTGTAA:hXFA?BE==BDFFA?>?FAA@?A?DEHA@=BB@B>C
HWUSI-EAS491_2:1:1:1612:1422:GAAAATTGCAAATCACGGAAAAAGAGCAATACACAG:hhXPAQJN=GLDIJIIF=DB@C@ACIA?C??N?G?@
HWUSI-EAS491_2:1:1:1410:1308:GAAATATGGCGACTAGAACCCAACAAGGGAGAAGCG:hg^IDMGLCDLIA?J@HKCAAGA@F?>X>@HJG=DG
HWUSI-EAS491_2:1:1:1723:1168:ACATGGGCGGCCGCCGCCGGCAGTGGCCGGTCGCGC:hQh@=?LC>AHD?BCBB?>?D?N?GDG?NB=AJFAA
HWUSI-EAS491_2:1:1:1586:1332:ATTATAGTCCTGAAGCTTTCCTCGAAGGTATATGCC:hhhJFMKMLNHL@A?EBD>MIB@EBI?BE?@DCCCN
HWUSI-EAS491_2:1:1:1686:1141:GATGGACGAGGGCTGGTACTGAGGGGAGGGGCTGCG:hORGFBAM>ECIID?@D=FFCDILE?GHBB>D>>A?
HWUSI-EAS491_2:1:1:1443:1504:GTTTTGTTTTGTTATTTGTCGATATATGTTTCCTTT:hJJUVGCAFINXOCEG@A?B>CBA??C>E?H@>@?I
HWUSI-EAS491_2:1:1:1559:1277:GACATTTGTCCGCCTCTTTCCATGCACTACGACATT:hO[E=BAJF?AA?=>F@?>BD?AK=?I==DB@GHAH>AM=??B>G

Using this file, I am trying to do mapping with bowtie.

Command line: bowtie -r -S bowtieindex/mm9 input file output.sam

But only 2 percent was mapped and 98% was not mapped.

I have no idea why it is.

Any comments or suggestions?

Thanks.

fastq fastq filter chip-seq bowtie

2 answers

According to what you write above, you are using the -r switch to Bowtie.

This is what the Bowtie manual says about the -r option:

-r

The query input files (...) are Raw files: one sequence per line, without quality values or names. All quality values are assumed to be 40 on the Phred quality scale.

So each line is supposed to be just a sequence, no quality, no name. Your example sequence is a bit weirdly formatted, but for sure it includes the name of the read at the beginning, so you can't use -r.

Another issue that could give this kind of result is if you use the wrong quality score scale. For the "phred+64" quality scale that Illumina data sometimes uses, you have to add the --solexa-1.3-quals option.

In addition to what @Mikael has said...

It looks like your input is FASTQ format--except messed up. Can you paste 8 lines directly from the file into your question? From your input above, somehow it looks like the 4 lines are merged into a single line.

Did bowtie give an error when you tried to run it? It should have been able to at least attempt to align 25% of the rows in your FASTQ file.

Maybe you'll also need to trim the tag from the left end of the read. You can do this with the --trim5 flag and specify the number of bases to skip in each read--likely 6 or so.

EDIT:

your data is not in FASTQ format. Save this into a file named tofq.py

import sys
for line in open(sys.argv[1]):
    header, seq, qual = line.rstrip().rsplit(":", 2)
    print "@%s\n%s\n+\n%s" % (header, seq, qual)

then run it as:

python tofq.py yourfile.not.fastq > output.fastq

where yourfile.not.fastq is the name of the file where you got the reads above. Then run output.fastq through bowtie.

if i run this file with bowtie -p 8 -S, then i got an error Error: reads file does not look like a FASTQ file terminate called after throwing an instance of 'int' Abort trap

If i try with -r option, there was no error, but i got poor mapping result like this:# reads processed: 5821424

reads with at least one reported alignment: 1449 (0.02%)

reads that failed to align: 5819975 (99.98%)

Reported 1449 alignments to 1 output stream(s)

And i just edited my question with the more information of the file.

If i try with bowtie --solexa1.3-quals --trim5 -S: Error: reads file does not look like a FASTQ file

if i run with bowtie --phred64-quals -5 6 -3 6 -S: Error: reads file does not look like a FASTQ file

see my EDIT above.

Log in to answer this question.