That's awsome, however, can blastn do this? I tried several options/tweak the parameter, but it did not work, any suggestion that can change the parameter of blastn to get similar results as GGGenome?
Thanks
Hi all,
I've designed a paired primers to amplify a specific target within CYP2C19. After checking the potential amplicons, we thought we could get a uniq amplicon by using the two primers as followed:
AGGCTTCAACCTAGTACAATGAAACCAGA
CCACTATTTCTGACACTGACAGACTGGA
However, after PCR, we did Sanger verification and found that the target is not a uniq band. We then blast the amplicon sequence and get a similar amplicon with the same length, which is considered as the reason for this amplicon mix or multiple bands.
What we did to screen the primers is to window-size the sequence and get the potential paired-primer using the similar parameters as NCBI-Primer-blast.
Is there any method to force the blast program to have more than 4 mismatches while cost a little for penalty, etc., allow 5 mismatches.
Best,
Junfeng
For Primer-Blast, I think you can tweak the "Primer Pair Specificity Checking Parameters".
To test whether your primer is truly unique, you may try GGGenome to search targets that are similar to your input sequences. A search using your first sequence yield 29 possible sequences with <= 5 mismatches. Another way is to use short-read aligner such as Bowtie to search against the genome.
That's awsome, however, can blastn do this? I tried several options/tweak the parameter, but it did not work, any suggestion that can change the parameter of blastn to get similar results as GGGenome?
Thanks
I don't know whether you can do this with BlastN or not. The minimum length of seed word to initialize the alignment is 7 nt, which likely affects the search results.
ThermoAlign is a primer design tool for tiled amplicon sequencing (includes multiplexing) using highly specific primers. Number of mismatches from sequence alignments might not be a good proxy for evaluating specificity of primers especially if you are trying to amplify repetitive regions of a genome.
Manuscript: http://www.nature.com/articles/srep44437
Log in to answer this question.