Hello everyone,
When I used the ABySS 1.5.2 to assemble my genome, I got this error:
Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...
Mateless 0
Unaligned 2237383 1.66%
Singleton 135502 0.101%
FR 18315 0.0136%
RF 3142164 2.33%
FF 128633640 95.4%
Different 627394 0.465%
Total 134794398
abyss-fixmate: error: The mate pairs of this library are oriented forward-forward (FF), which is not supported by ABySS.
I have reversed the PE reads (retained the left reads, only reverse complement the right reads), but this error can't be fixed.
Could anyone provide some suggestion to fix this?
Thanks
•
written
by
yangyongzhi2008 •
Well, it looks like read 2 did not get reverse-complemented. You can reverse-complement it with Reformat from the BBMap package:
reformat.sh in=read2.fq out=reversed.fq rcomp
Or if the reads are interleaved in a single file:
reformat.sh in=reads.fq out=reversed.fq rcompmate
I used this software to reverse and complement the read2.fq, but it doesn't work. The error still exists. Could you give me some other advice?
I've fixed the same error by correcting read IDs in fastq files. I've trimmed to first space character in the read ID (so that reads in pair have the same ID) and add /1 for reverse reads and /2 for forward reads in the end.
@SRR1920959.1 HWI-ST1023:288:HAW6AADXX:2:1101:1201:2190 length=101
ACAACACAACTACCACCAATAAAACCTGAACATGAGGTACCACTTGATGCTGGAGGGAGTCCAGTAGGTAACATGGGTACCAACTCGAATAACAACAACGN
+SRR1920959.1 HWI-ST1023:288:HAW6AADXX:2:1101:1201:2190 length=101
CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJHHIJJJJJJJJJJJJJJJJJJJJIJJHHEHHCDFFFFFEDACEDDDDDDDDDDDDDDDDDDDDD
@SRR1920959.1/1
ACAACACAACTACCACCAATAAAACCTGAACATGAGGTACCACTTGATGCTGGAGGGAGTCCAGTAGGTAACATGGGTACCAACTCGAATAACAACAACGN
+SRR1920959.1/1
CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJHHIJJJJJJJJJJJJJJJJJJJJIJJHHEHHCDFFFFFEDACEDDDDDDDDDDDDDDDDDDDDD
Log in to answer this question.
