Hi,
I have downloaded a few tissue bam files from illumina body map from the link ftp://ftp.ensembl.org/pub/release-81/bamcov/homo_sapiens/genebuild/
Now to get the read counts from each of the tissue sample bam files, I did HTSeq analysis. But unfortunately for a few tissues it worked really well but for a few tissues it ended up showing different error each time I run HTSeq analysis.
The HTSeq command I am using for processing bam files is
samtools view GRCh38.illumina.ovary.1.bam |\
htseq-count -i gene_id - Homo_sapiens.GRCh38.80.gtf > htseq.ovary.results.txt
shows an error
Error occured when processing SAM input (line 2):
'pair_alignments' needs a sequence of paired-end alignments
[Exception type: ValueError, raised in __init__.py:603]
I tried sorting the sam files too, but still it didn't work :( Showed error:
Error occured when reading beginning of SAM/BAM file.
[Exception type: StopIteration, raised in count.py:88]
How to solve this issue please help, someone!
1 answer
The error is clear this time. SAM line does not contain at least 11 tab-delimited fields.', 'line 1' there is something wrong with your file. Why don't you paste few lines
samtools view <in.bam> | head
•
written
by
GouthamAtla
I am sorry for the delay in response, this is how to file looks like
HWI-BRUNOP16X_0001:3:64:13105:149752#0 97 KI270757.1 49010 0 50M 8 89223567 0 GCCAAAATTGACAAAT GGGATCTAATTAAACTAAAGAGCTTCTGCACAGT eaceaddfffdggggdggcdgfgfgggggfggggfdgggdgggdgggggh RG:Z:ovary_50_fca XT:A:R NM:i:0 S M:i:0 AM:i:0 X0:i:69 XM:i:0 XO:i:0 XG:i:0 MD:Z:50
HWI-BRUNOP16X_0001:6:25:9464:120176#0 0 KI270757.1 63302 25 75M * 0 0 TGGTGAGCAATTTTTTCATGTGTT TTTTGATTTGCATTTCTCTGATGGCCAGTGATGGTGAGCAATTTTTTCATG gaggggggggggggggggggggggggfffgggggggggggfgggeggggggggggggghgggggegggggggggg R G:Z:ovary_75_fcb XT:A:U NM:i:37 X0:i:1 X1:i:0 XM:i:37 XO:i:0 XG:i:0 MD:Z:9T20C1G0C0A0T0G0A0A0T0G0T0C0T0T0C0T0T0T0T0G0A0G0A1G 0T2C0T1T0T0C0A1G1C0C0T0T2
HWI-BRUNOP16X_0001:6:66:18737:92611#0 0 KI270757.1 67475 0 75M * 0 0 GATGTGGAGAAATAGGAACACTTT TACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGT ggggggggghgggggggggggggggfgggggggggfgggggggfgggggggggghgggggggefggggggggfef R G:Z:ovary_75_fcb XT:A:R NM:i:0 X0:i:4670 XM:i:0 XO:i:0 XG:i:0 MD:Z:75
HWI-BRUNOP16X_0001:6:43:20784:119867#0 0 KI270757.1 67490 0 75M * 0 0 GAACACTTTTACAGTGTTGGTGGG ACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGTG gfggggggggggggggggggegggggggggggggggggggfgggfggggggggggfgfgfegggaeggggggghe R
Thanks, the issue was solved using the following commands
samtools view -bf 1 GRCh38.illumina.ovary.1.bam > ovary.bam
samtools view ovary.bam | python -m HTSeq.scripts.count --type=CDS --idattr=gene_id --mode=union --stranded=yes - Homo_sapiens.GRCh38.80.gtf
Log in to answer this question.
-
Error with HTseq RNAseq read count
written by Catalina •
-
htseq gene atrribute error
written by Balatheskulter •
-
Error with HTseq RNAseq read count
written by Bioinfonext
-
HTSeq error while counting reads
written by makwana.kd •
-
HTseq code error repeatedly
written by bnayer26 •
-
Error in HTSeq
written by glady
-
run htesq-count error
written by yhui_qiu •
-
HT-seq error and empty result
written by biologo •
-
htseq-count error: "does not contain 'gene_id'
written by lynne.m.a.harris •
-
Error at the end of HT-seq Analysis and output.txt with 0 bytes in size
written by tiago211287
