This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Find the mapped read sequences to a specific gene from bam file

Hello all,

I would like to see the all read sequences which are mapped to specific miRNA (e.g. mmu-mir-320, mmu-mir-32) Since I would like to check whether my miRNAs comes from 3p- or 5p-.

microRNA target finding : 3p vs 5p?

I guess I can use samtools but I am not sure how I can exactly do it. I searched but I could not find it.

Could you please let me know about this?

Thanks

samtools
• 5,792 views • link
updated by Ram Ram • written by illinois.ks illinois.ks

1 answer

Your miRNA was your original query? Then you can just use

samtools view -h <sam/bam file> <mmu-mir-320> > new_sam.sam

You just have to add a reference name after the regular view statment, this is the name of the contig that it aligned to, and you can even specify a region.

Just look at the samtools man page http://www.htslib.org/doc/samtools.html at REGIONS

• 0 views • link
updated by Ram Ram • written by Lesley Sitter Lesley Sitter

Hello,

I have used following command as you suggested. However, Still have no idea to figure out it tit 3p or 5p.

samtools view -h C1_whole_mmu_sorted.bam chr14:70443510-70443591 > out.sam

that region(chr14:70443510-70443591) was indicated by mir-320 region.

(http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0000704) And I got the following result in my out.sam file.

M02847:38:000000000-ACP9R:1:2104:20206:14266    0       chr14   70443556        9       9S19M   *       0       0       ACGATCGGAGAAAAGCTGGGTTGAGAGG    CGGGGGGGGGGGGGGGGGGGGGGGGGGG
M02847:38:000000000-ACP9R:1:2105:17067:3396     0       chr14   70443556        25      22M1S   *       0       0       GAAAAGCTGGGTTGAGAGGGCGC CGGGGGGGGGGGGGGGGGGGGGG AS:i:44 XS:i:36 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:     22        YT:Z:UU
M02847:38:000000000-ACP9R:1:2111:6937:20111     0       chr14   70443556        39      20M1S   *       0       0       GAAAAGCTGGGTTGAGAGGGA   CGGGGGGGGGGGGGGGGGGGG   AS:i:40 XS:i:30 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:     20        YT:Z:UU
..

Is it a mir-320-3p or mir-320-5p?? So confusing :(

• 0 views • link
updated by Ram Ram • written by illinois.ks illinois.ks

It's 3p

• 0 views • link
updated by Ram Ram • written by Asaf Asaf

Thank you so much. I see by looking at the real sequences, we can see it comes from 320-3p....

I know mir-320-5p

gccuucucuucccgguucuucc

mir-320-3p

aaaagcuggguugagagggcga

As you said, if my reads are mapped to miRNA-320-3p, then, I need to only find targets of mir-320-3p.. NOT mir-320-5p targets based on the databases.. RIGHT? ( I would make sure I don't make any mistake here.! ;))

I can just ignore the targets of miRNA-320-5p?

So, still I need to consider target genes of both (320-5p, 320-3p?)

Thank you in advance.

• 0 views • link
updated by Ram Ram • written by illinois.ks illinois.ks

Yes, you are correct, since the 3p is the only mature side, you should seek for its targets only.

• 0 views • link
updated by Ram Ram • written by Asaf Asaf

Thank you so much! :)

• 0 views • link
updated by Ram Ram • written by illinois.ks illinois.ks

Log in to answer this question.

More posts like this