This is a test version of Biostars. For the public version, visit https://www.biostars.org.
flagstats results show 0.0 % properly paired reads

Hi Everyone!

I used samtools Flagstats walker. I am getting 0.0% properly paired reads in the BAM file. I sorted my BAM file and marked the duplicates as well. is there any BAM FLAG is missing in my file or mapping results are bad quality. Note that my average mapping quality (MAPQ) is more than 30.. I used bwa-mem for mapping to reference genome. I did not mark any duplicates in this step.

Can you please help help me tracking this issue?

My command arguments were:

samtools flagstat /CHG000691/CHG000691_PE_02AL3.sam > /Flagstat/CHG000691/lanewise/CHG000691_PE_02AL3_flagstat.txt

Output:

75031887 + 0 in total (QC-passed reads + QC-failed reads)
733759 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
74460957 + 0 mapped (99.24%:-nan%)
74298128 + 0 paired in sequencing
37149064 + 0 read1
37149064 + 0 read2
0 + 0 properly paired (0.00%:-nan%)
73397388 + 0 with itself and mate mapped
329810 + 0 singletons (0.44%:-nan%)
2837608 + 0 with mate mapped to a different chr
982994 + 0 with mate mapped to a different chr (mapQ>=5)

Thank you very much!

next-gen alignment

It would be helpful if you could answer these questions -

  1. What was your bwa mem command?
  2. What was the library type? (e.g. fragment, LMP [plus CLRS, Nextera, etc.])
  3. What was the expected insert size and orientation?
  4. Are you sure the sequencing was paired?
  5. If you used 2 files (rather than interleaved), are you sure the two files go together?
  6. What kind of preprocessing did you do? (For example, fastx toolkit is notorious for destroying pairing order and should never be used with paired reads, or ever, IMO).
  7. What kind of experiment is it? DNA, RNA, etc.
  8. What version of bwa are you using?

You can validate that the names appear to be correctly paired with the BBMap package:

reformat.sh in1=r1.fq in2=r2.fq verifypaired

If the reads are interleaved in a single file, use the verifyinterleaved flag instead.

In any case, it's odd that 0 reads are paired. I would expect there to be a few just by random chance out of 75 million (though that depends on the genome size). I'm guessing that bwa treated these as single-ended.

1. What was your bwa mem command?

bwa mem -t 5 \
  -R '@RG\tID:02AL1\tSM:HMN15-1\tLB:hs\tPL:illumina' \
  -P \
  -M ./human_g1k_v37.fasta \
  ./S17_02A_CHG000691_L001_R1.fastq.gz ./S17_02A_CHG000691_L001_R2.fastq.gz \
  > ./CHG000691/CHG000691_PE_02AL1.sam

I think it might be due to the -P option, but I am not sure, because it is written in BWA manual: "In the paired-end mode, perform SW to rescue missing hits only but do not try to find hits that fit a proper pair."

2. What was the library type? (e.g. fragment, LMP [plus CLRS, Nextera, etc.])

Fragment-Sonicator

3. What was the expected insert size and orientation?

Forward-Reverse (FR)   (-----> <----)
insert size 300-500

4. Are you sure the sequencing was paired?

Yes, I am sure the sequencing was paired-end. as you can see the flagstat output:

     74298128 + 0 paired in sequencing
     37149064 + 0 read1
     37149064 + 0 read2

5. If you used 2 files (rather than interleaved), are you sure the two files go together?

Yes.. :)

6. What kind of preprocessing did you do? (For example, fastx toolkit is notorious for destroying pairing order and should never be used with paired reads, or ever, IMO).

No preprocessing was performed.

7. What kind of experiment is it? DNA, RNA, etc.

Whole Genome DNA Sequencing

8. What version of bwa are you using?

BWA-Version: 0.7.12-r1039

You could easily check if -P is the culprit, by repeating the alignment omitting it.

Can you please post the output of head for the two FASTQ files? If they're gzipped, you can do this by typing zcat [fastq_file] | head

@Dan D

here is the output:

First File:

$ cat S17_02A_CHG000691_L001_R1.fastq | head

@ST-E00169:61:H2CCHCCXX:1:1101:7475:1713 1:N:0:TCCGCGAA
CCACAAAAGGAGTATGTCAAAACTGGTCTATCAAAAGAAAGGTTCATCTCTTGGAGGTGAATGCACATATCACAAAAAAGTTTCCAAGATGGCTCCTGTCTAGATTATATGTGAAGATATATCATTTTCTCCCAAAGGCTGCATAGCGCT
+
AAFFFAFKKKKKAAF,AFK7,K,<FKF<FA7FF,AKFKKKKK7FFKK<,7F<FAKFFAFKKKK,<,<<<A<KA,A,7,K<,,,,,,,A<A,,77,<7A,,,,F,,7,A,AF7FA7A77F<,,<,,,AFAKK,A<F7,<7A,(,7,,<,7A
@ST-E00169:61:H2CCHCCXX:1:1101:8815:1713 1:N:0:TCCGCGAA
TGATAGAGCAGTATTGAAACACTCTTTTTGTGGAAAATGCAAGTGGATATTTGGATATCTTGGAGGATTTAGTTGGAAGTGGGAATTCACATAAAAGGTATACAGCAGCATTCTCAGAAATTTCTTTCTGATGTCTGCATTCAACTAATA
+
AAFFFKKKFKKFKAA7FKK,F7<AA,<<FAFK7KKFK7F7AF7,AA,77FKKKKKKKKKKKKK,FK,7FA,AK<AAA,<,7,7F7FFKKA,,AK7AFAKK7K,FAK,AAKKKKFFKFFKKKAKA7AFKKK7AKKKKK<,A77<AKK,<AF
@ST-E00169:61:H2CCHCCXX:1:1101:12835:1713 1:N:0:TCCGCGAA
CATGTGAATNGAAAATTATAAGAGAAGTCATTATATGAACAAGACATATGCACACACATGCTTCTAGCAGAACAAGTAAAAATTGCAAAGATATAGACCTGACGTAAGTGCCCATCAAACAGTGGGTGGATAAAGAAAATGTGGTATATA

Second file:

$ cat S17_02A_CHG000691_L001_R2.fastq | head

@ST-E00169:61:H2CCHCCXX:1:1101:7475:1713 2:N:0:TCCGCGAA
ATCCTGAGGAACTTATTTGTGATGTGTGCATTCATCTCAAAGAGTTGAACTTTTCGTTTGATTGCATAGTTTTAAAATACTCTTTTTGTAGAATTTGTATGTGGAAATTTGGGGCGCTTTGCGGCCTTTGGGTGGAATTGAAATATGTTC
+
AA,7FKKKKAKAFF,7FKKKFF7FFFFF,F<F,A<7AF7AFF,F7FKKFFFFFF7,7FFFKK7F,7<,A7K7,,A7<,A<FK<F<K,FKFFA,A,<<,,,,7,7,,,7,,,7,7((((,7<,,,,(,,,,,,,,(,,,,,,,,,,,,,,,
@ST-E00169:61:H2CCHCCXX:1:1101:8815:1713 2:N:0:TCCGCGAA
AAATAGAGTTTCAAAGCTGCTCTGTAAAAAGAAAGGTTCCACTCTGTTAGCTGAGTACACACATCACAAACTTGTTTCTGAGAATCCTTCTGTCTCGTTTTTATGGGAAGATATTCCCTTGTTCACCGTAGGCATCAAAGCGCTTCAAAT
+
AA,7,,A,,7<7AA,7,7FA77FK7FFFFFF,K,<A,,,,F,,AFFAKA,,A,7FA,,A<,FAKF,,,A,F7AFKKK7FAAA,7FK<FF,7<FAF7<AAFFK,<<AA,A<FFKK77,<AF,A,7<F,7A77A,AFA,,A7,,,,,,,,,,
@ST-E00169:61:H2CCHCCXX:1:1101:12835:1713 2:N:0:TCCGCGAA
CTCATAGCTTAGCTCCCACTTATAAGTGAGAACATGTGATATTTGGTTTTCCATTCCTGAGTTACTTCATTTAGAATAATGGTCTCCCATCTCCATTCAAGTTACTGCAAAAGACATTACGTAATTCCTTTCTATGGCAGAGAAATCTTC

Did you ever figure out why this was happening? I'm having the same issue and can't figure out why.

1 answer

@joshuau490

Hi, Please find the answer in my posted thread at:

https://gatkforums.broadinstitute.org/gatk/discussion/5786/gatk-flagstats-show-0-0-properly-paired-reads

hope it helps.

-sohail

This link is no longer available. I have the same problem, could you please indicate what was the solution in your case?

Thanks

Alejandro

Log in to answer this question.