How To Convert Wgsim Output Into A Vcf File?

wgsim produces a list of indels that looks like:

20 60231 AGCCTGTGC - -
20 60245 C M +
20 62235 CC - -
20 62264 A W +
20 64847 CCATGGCAGAGTAGAGAATATGTAC - -
...

Is there a way to convert (automatically) this output into a VCF file?

Regards, Pascal

vcf

• 2,173 views • link

written 14.7 years ago by Pascal

Would also be interested in this...

• 0 views • link

written 7.6 years ago by cmdcolin

0 answers

No answers yet.

More posts like this

How to convert amino acid sequence to numbers
written 4.4 years ago by nrizzolo1796 •

I have this file files = list(SeqIO.parse("proteasomes.fasta", "fasta")) Which is a list of proteasome Amino Acid sequences like "MALASVLERPLPVNQRGFFGLGGRADLLDLGPGSLSDGLSL..." I want to convert each letter …
Error in freebayes SNP calling
written 6.0 years ago by evelyn

Hello, I am using `freebayes` to make a `vcf` from a list of `.bam` files (duplicates removed): RUN=${SLURM_ARRAY_TASK_ID} LIST_OF_BAMS=/path/list_of_bam.txt freebayes \ -f /path/genome.fasta \ -L …
Convert indel list with [-/A] notation to VCF with adjacent base
written 7.6 years ago by Chris Miller

I couldn't find a previous answer to this question, but have to believe something exists! I'm trying to take a list of mutations that looks …
varscan2 mpileup2snp output contains indels
written 10.4 years ago by AW

Hi all, I ran varscan2 mpileup2snp but I see that the vcf output file contains indels? Record(CHROM=TR1087|c2_g1_i4, POS=1195, REF=TAAAAAAAAA, ALT=[AAAAAAAAAA, TA, T, TAAAA, TAAA, TAA, …
vcf-merge gives empty output or run forever
written 10.5 years ago by ste.arnoux •

Hi everyone I have this problem since few weeks now. I try to run a vcftools-merge (because I have vcf fils with sequences data) and …
Bowtie Outputs Hits That Are Shorter Than The Reads Aligned
written 12.7 years ago by Click downvote

I have a file that looks like <blockquote> >rno-miR-322 MIMAT0001619 Rattus norvegicus miR-322 CAGCAGCAAUUCAUGUUUUGGA >rno-miR-322* MIMAT0000547 Rattus norvegicus miR-322* AAACAUGAAGCGCUGCAACA </blockquote> The reads …
Converting Wgsim Output To Vcf
written 14.6 years ago by Pascal

Hi Since I haven't found any tool that does it I will try to do myself a small script that convert the wgsim output (indels) …
Structural Variation Detection On A Short Reads Simulation
written 14.7 years ago by Pascal

Hi, I am trying to do the following exercise (still playing with indels): <ol> <li>simulate short reads (and indels) out of a human genome chromosome,</li> …
Short Read Simulator For Cnv Indel?
written 14.7 years ago by Pascal

Hi Is there a way to simulate short reads with CNV indel (1-50kb)? I've read wgsim manual for instance but it looks to generate small …
Parsing Dimplot Result Files And Annotation
written 15.5 years ago by Samimirza •

I have results from Dimplot in two files named filename1 and filename2 in my program. The results look like: <pre><code>1a2y HIS A 30 PO4 C …