This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Why the AT_covd CG_covg CpG_covd is zero???what happened with them?

hi,everyone

I have some problems in sample1.covg that is the part of genome music calc-covg.

#Gene    Length    Covered    AT_covd    CG_covd    CpG_covd
xuhb    13    13    0    0    0

Why the AT_covd CG_covg CpG_covd is zero? What happened with them?

My roi file has one line.

1 3 15 xuhb

My seq.fa is as follows:

>1
gaattcttcaaagagttccagatatccacaggcagattctacaaaagaag

My normal.fq is as follows:

@SEQ_ID
aattcttcaaagagttcca
+
2222222222222222222

My tumor.fq is as follows:

@SEQ_ID
aattcttcaaagagttcac
+
2222222222222222222

My bam-list file has one line as follows:

sample1 normal.bam tumor.bam

The command which I use is as follows:

genome music bmr calc-covg --bam-list bam1-list --output-dir ex1  --reference-sequence seq.fa --roi-file roi --normal-min-depth 1 --tumor-min-depth 1 --min-mapq 0;

Thank you very much.I am so worry about that problems.

genome music calc-covg

It's likely simply an issue with using lower-case characters in the .fa file

0 answers

No answers yet.

Log in to answer this question.