If they are not in the same order, you may use unix sort on your fasta (e.g. Pierre Lindenbaum answer here) and on your weights files.
insert weight values in multifasta file
Hello, I would like to know if there is a way to insert the weight information from a file in each fasta header of a multifasta file, example:
File 1:
>header_1
CACGGTGGGATCGACCTTTTGCCGCTCGAGGGATTTCTGCACCCTGCCGA
>header_2
TGGAACAAGGCCGGCCTGCGCGGCTAGGTGATCAACAAGGGGTTCAACGG
>header_3
GCGAAAGCGATACCTGGACTCGCAGAACGAAGACCTGGCCGAAGCGGTGG
>header_4
GGTTTAGAACGTCGTGAGACAGTTCGGTCCCTATCTGCCGTGGACGTTTG
File 2:
>header_1 weight=5
>header_2 weight=7
>header_3 weight=9
>header_4 weight=1
Output:
>header_1 weight=5
CACGGTGGGATCGACCTTTTGCCGCTCGAGGGATTTCTGCACCCTGCCGA
>header_2 weight=7
TGGAACAAGGCCGGCCTGCGCGGCTAGGTGATCAACAAGGGGTTCAACGG
>header_3 weight=9
GCGAAAGCGATACCTGGACTCGCAGAACGAAGACCTGGCCGAAGCGGTGG
>header_4 weight=1
GGTTTAGAACGTCGTGAGACAGTTCGGTCCCTATCTGCCGTGGACGTTTG
1 answer
Are you looking for something like this?
awk 'BEGIN{RS=">"}NR>1{sub("\n","\t"); gsub("\n",""); print RS$0}' file.fa | paste - weights.txt | awk -F'\t' '{print $3"\n"$2}'
This command only will work assuming that the order in the sequences of fasta file and the order of weigths is the same (as your example).
Log in to answer this question.
More posts like this
-
How to split a long protein sequence in small sequences with same header?
written by FelipeMSD •
-
Match a column to another file (grep/awk)
written by Nathan •
-
How to add taxonomic information for each fasta header ?
written by v.berriosfarias •
-
How to calculate average of each column and the data in separate file?
written by sadstudent •
-
merge two multifasta files
written by erick_rc93 •
-
multiple DNA file Sliced to a fixed length substring by index/location
written by jamesdong •
-
combine columns from multiple files
written by bk11 •
-
Merging data coloum wise in R
written by David_emir
-
Extracting fasta sequences with identical header
written by seta
-
Multifasta Headers To Tab
written by pedroxantos •
