This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Accessing String-Db Through Psicquic

I'm trying to access the String DB through PSICQUIC for fetching protein-protein interaction data of a particular model organism.

The typical output from PSICQUIC is like this

Where the last field contains the score e.g score:507(free-text). However, this score is different from what String-DB web site reports, which has a fractional value.

Can anyone tell me what typical cut off score I can use for PSICQUIC derived STRING data?

Thanks

WoA

ppi retrieval
• 4,718 views • link
updated by Michael Kuhn Michael Kuhn • written by Woa Woa

I think the score that is available with downloadable files from StringDB is the confidence score multiplied by 1000. As the confidence score lies between zero and one it cant't exceed 1000, but I'm having score like 76000 !!!

• 0 views • link
written by Woa Woa

Hello, as noted below, the bug in STRING should be fixed now.

• 0 views • link
written by Michael Kuhn Michael Kuhn

Thanks a lot for the update

• 0 views • link
written by Woa Woa

1 answer

In this case, the score is multiplied by 1000, so the actual score is 0.507. In your example, the last interaction (ARF5 and CAPNS1) has "score:452(free-text)", and the STRING web interface gives a score of 0.452.

• 0 views • link
written by Michael Kuhn Michael Kuhn

indeed, there seems to be a bug here. I'll forward this.

• 0 views • link
written by Michael Kuhn Michael Kuhn

Sorry that was the 11th Entry and NOT 8th

• 0 views • link
written by Woa Woa

that was my mistake, a bug in the score calculation, only for database transferred scores. have a look again now

• 0 views • link
written by User 8255 • User 8255

(the unknown Googler was a member of the STRING development team)

• 0 views • link
written by Michael Kuhn Michael Kuhn

(the unknown Googler is a member of the STRING development team)

• 0 views • link
written by Michael Kuhn Michael Kuhn

Log in to answer this question.

More posts like this
  • Parsing Non-Coding Region Around Protein Of Interest From Embl File
    written by Pappu Pappu
    <p>I want to parse noncoding DNA sequences around a protein (P08707) from an embl file: <a href="http://www.ebi.ac.uk/ena/data/view/U32222&amp;display=txt&amp;expanded=true">http://www.ebi.ac.uk/ena/data/view/U32222&amp;display=txt&amp;expanded=true</a> </p> <p>I could grep '^ CDS' and then …
  • Getting Go-Annotation Data In Computer Readable Format
    written by Genotepes Genotepes
    <p>Hi</p> <p>I'd like to perform gene enrichment analyses of my own (statistical test close to GRAIL method). For that I would only need the <a …
  • How To Generate Pdbids Of Interacting Partners From String Api
    written by Reyhaneh Reyhaneh
    <p>I have been using <a href="http://string-db.org/newstring_cgi/show_input_page.pl?UserId=bpVHUrJ0fxWe&amp;sessionId=JozNpBSo0rXY">STRING</a> to generate interacting partners of a specific protein. (based on <a href="http://www.biostars.org/post/show/46943/generating-all-interacting-partners-of-a-protein/">this post</a>).</p> <p>In the graphical version when for …
  • International Protein Index: No Entries Found
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>I've been asked to retrieve the fasta sequences of a set of proteins identified by their <a href="http://www.ebi.ac.uk/IPI/IPIhelp.html">International Protein Index</a>. I've been using <a href="http://www.ebi.ac.uk/Tools/dbfetch/dbfetch">http://www.ebi.ac.uk/Tools/dbfetch/dbfetch</a> …
  • Refseq Error: Insufficient Same-Species Transcript Support
    written by Woa Woa
    <p>I've encountered a few supressed RefSeq entries like <a href="http://www.ncbi.nlm.nih.gov/protein/NP_033730">this</a> </p> <p>which tells that : "This RefSeq was temporarily suppressed because currently there is insufficient …
  • Translating A Mitochondrial Cdna
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Here is the cDNA for the UCSC knowngene <strong>uc011mfh.1</strong> , a protein said to be on the <strong>chrM</strong>:5,855-7,427. <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&amp;db=hg19&amp;position=uc011mfh.1">http://genome.ucsc.edu/cgi-bin/hgTracks?org=Human&amp;db=hg19&amp;position=uc011mfh.1</a></p> <pre><code>ATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCG TAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTA CTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAAT AGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTAT TCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATC …
  • Cytoscape Plug-In For Retrieving Protein-Protein Interactions
    written by Woa Woa
    <p>I wish to find out all interactions WITHIN a set of around 200 HUMAN proteins. The identifiers I can use are gene<em>name, Uniprot</em>accession and Uniprot_Ids. …
  • Problem Fetching Genomic Sequence From Ddbj
    written by Woa Woa
    <p>I'm trying to download some genomic sequences for a recently sequenced <a href="http://www.nature.com/nbt/journal/v29/n8/full/nbt.1932.html">cell line</a>(The article is open access) from DDBJ. The Accession nos. are AFTD00000000 …
  • What Is The Best "Public" Resource For Protein-Dna Interactions?
    written by Keiichiro Ono Keiichiro Ono
    <p>Hi. I'm a developer of biological network analysis/visualization software called <a href="http://www.cytoscape.org/">Cytoscape</a>. I'm planning to create a short tutorial for absolute beginners of biological network …
  • The Quickgo/Gannotation Api
    written by Pierre Lindenbaum Pierre Lindenbaum
    <p>Hi all,</p> <p>I'm trying to retrieve all the annotations for a given GO term using the <a href="http://www.ebi.ac.uk/QuickGO/WebServices.html">QuickGO WebService</a>. But the service is <a href="http://www.ebi.ac.uk/QuickGO/clients/QuickGO.wadl">poorly …