Biostar Beta. Not for public use.
Downloading SRA data using the SRA Toolkit
0
Entering edit mode
12 months ago
F ♦ 3.4k
Iran

Hey,

i opened cmd and typed C:\Users\yang\Downloads\Compressed\sratoolkit.2.5.0-win64\bin

then i typed fastq-dump -X 5 -Z SRR390728

in cmd i am watching

C:\Users\yang\Downloads\Compressed\sratoolkit.2.5.0-win64\bin\fastq-dump -X 5 -Z

SRR390728
Read 5 spots for SRR390728
Written 5 spots for SRR390728
@SRR390728.1 1 length=72
CATTCTTCACGTAGTTCTCGAGCCTTGGTTTTCAGCGATGGAGAATGACTTTGACAAGCTGAGAGAAGNTNC
+SRR390728.1 1 length=72
;;;;;;;;;;;;;;;;;;;;;;;;;;;9;;665142;;;;;;;;;;;;;;;;;;;;;;;;;;;;;96;;;;(
@SRR390728.2 2 length=72
AAGTAGGTCTCGTCTGTGTTTTCTACGAGCTTGTGTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGT
+SRR390728.2 2 length=72
;;;;;;;;;;;;;;;;;4;;;;3;393.1+4;;5;;;;;;;;;;;;;;;;;;;;;;;;9;;;;;;;464262

(.....)

where i can find the downloaded file???? i was going to download a sra file from GEO.

ADD COMMENTlink
1
Entering edit mode
9 weeks ago
genomax 68k
United States

Since this old thread has been re-activated I will add two current methods that should be used for this purpose instead of using SRAtoolkit:

ADD COMMENTlink
0
Entering edit mode

genomax as you suggested to me already, Fast download of FASTQ files from the European Nucleotide Archive (ENA) is quite applicable

ADD REPLYlink
0
Entering edit mode

This tutorial also contains a section on how to use the sratoolkit (prefetch and fastq-dump) efficiently (bottom of the tutorial).

ADD REPLYlink
0
Entering edit mode
11 months ago
Freiburg, Germany

While you could download the file from GEO (or just directly from SRA), it would seem easier to just remove the -Z option and allow fastq-dump to write the fastq files for you. Exceedingly few programs directly accept SRA files, but pretty much everything will take fastq.

BTW, that's a paired-end dataset, so make sure you specify --split-files.

ADD COMMENTlink
0
Entering edit mode

By default (now in 2019), one should use --split-3 to separate potential singletons that might mess up the pairwise structure of the two mate fastq files which eventually might crash the aligner.

ADD REPLYlink
0
Entering edit mode
11 months ago
cigdemselli • 10

The default location for the "download repository" is:

Linux: /home/[user_name]/ncbi/public
Mac OS X: /Users/[user_name]/ncbi/public
Windows: C:\Users\[user_name]\ncbi\public

Please see this link for more details: https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc&f=std#s-4

ADD COMMENTlink
0
Entering edit mode

Hi, welcome to Biostars :)

Please use the formatting bar to indicate code examples, paths, example data etc. I did the changes for you this time.

enter image description here

ADD REPLYlink
0
Entering edit mode
12 months ago

I had to use the find command to find the directory which is located at the root directory rather than the user directory. prefetch downloads SRA data to ~/ncbi/public/sra despite having the tools installed at /home/[user-name]/ncbi

ADD COMMENTlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.1