This is a test version of Biostars. For the public version, visit https://www.biostars.org.
how I can install lumi, plier, simpleaffy, oligo classes, LMGene and siggens packages?

When running a program it says that lumi, plier, simpleaffy, oligo classes, LMGene and siggens packages needed to be installed in R, after installing again the same massages

I am in Windows seven 64 bit

Even after installing, it requests more packages and an endless process

What can I do?

Please...

r
• 4,540 views • link
updated by Ram Ram • written by zizigolu zizigolu

3 answers

Sarah,

There are always problem like this and even I faced it several times, when I was using R on Windows.

There are number of solutions for it.

1. Check that your packages are getting installed at a particular directory and R have it's library path set to that directory only. If you need help regarding this, than go through: http://stackoverflow.com/questions/15170399/changing-r-default-library-path-using-libpaths-in-rprofile-site-fails-to-work

2. If packages are from CRAN, you could install them through

install.packages("package_name")

3. If the packages are from Bioconductor, use this:

source("http://bioconductor.org/biocLite.R")
biocLite("package_name")

You can also install CRAN packages through biocLite()

4. If that doesn't help, download the packages from their site (package_name.zip) and install them through:

install.packages("path_of_download_package/package_name.zip", repos = NULL)

5. Another thing you could try is: if the author made the package available through Github, you can install it from there as well. To learn about this, see: http://www.inside-r.org/packages/cran/devtools/docs/install_github

• 0 views • link
updated by Ram Ram • written by Deepak Tanwar Deepak Tanwar

thank you all. I will try

• 0 views • link
updated by Ram Ram • written by zizigolu zizigolu

Hello Deepak

I have two fasq files, first set are the footprints, while the second sets are data coming from a common RNA-seq experiment performed in parallel, I want to adapter sequences, using the software CUTADAPT

The adapter sequences are:

GTTCAGAGTTCTACAGTCCGACGATC # 5 prime adapter sequence
ATCTCGTATGCCGTCTTCTGCTTG # 3 prime adapter sequence

May you please tell whether and how I can do this project with Windows seven 64 bit? because I am not familiar enough with linux

Help me please

• 0 views • link
updated by Ram Ram • written by zizigolu zizigolu

How is this relevant to your original enquiry? If you have a new question, please post a new question, don't append questions to unrelated topics.

• 0 views • link
updated by Ram Ram • written by User 59 User 59

You know, last night my supervisor asked me to work on adaptor removing although I have error when launching the previous program yet

I read that Deepak knows about python, I thought about his help

• 0 views • link
updated by Ram Ram • written by zizigolu zizigolu

Hi Sarah,

First of all, @Daniel Swan is right. You should post always new questions, if the topic was unrelated. I saw that you posted new question (Good). This also helps for other searchers. If in future, some other user find same problem, he/she would be able to find the answer directly, instead of posting questions. I do appreciate your concern of directly asking question to me. I am just in very initial stage of my career. I have only Undergraduate degree in Bioinformatics. You also could be more ahead of me. There are very very experienced people present on biostars and they can give you more appropriate answers.

I would also suggest you to move to LINUX, as soon as possible. Windows is not for Bioinformaticians. Once you get to work with linux commands, your more than 50% task would be easy. Linux is easy to install and easy to work with and its free. If you find difficulties, internet and/ or biostars are always there to help you out.

Another thing I would suggest you, is to update your profile over Biostars. So that people would know about your background. Link your Linkedin account with your account.

If you want to contact one person specifically, you could find their account linked or their websites.

• 0 views • link
updated by Ram Ram • written by Deepak Tanwar Deepak Tanwar

you are right, Deepak

• 0 views • link
updated by Ram Ram • written by zizigolu zizigolu

http://www.bioconductor.org/install/

• 0 views • link
written by User 59 User 59
  • If Linux, run rstudio from the command line with sudo to get full access: sudo rstudio
  • If Windows, run rstudio as administrator. Hit with the right button on the icon to find the menu
• 0 views • link
updated by Ram Ram • written by Antonio R. Franco Antonio R. Franco

Log in to answer this question.

More posts like this