This is a test version of Biostars. For the public version, visit https://www.biostars.org.
presence of Adaptators whereas read's =100 b ?

Hello guys,

I got 2 files: read1.fastq and read2.fastq, after to have done a mapping with bwa (each reads are 100 b) I've checked the bamtools stats and have this:

***********************************************
Stats for BAM file(s):
***********************************************

Total reads:       820130832
Mapped reads:      812921517    (99.121%)
Forward strand:    418786804    (51.0634%)
Reverse strand:    401344028    (48.9366%)
Failed QC:         0    (0%)
Duplicates:        0    (0%)
Paired-end reads:  820130832    (100%)
'Proper-pairs':    342545373    (41.7672%)
Both pairs mapped: 787752117    (96.052%)
Read 1:            431818871
Read 2:            388311961
Singletons:        25169400     (3.06895%)
Average insert size (absolute value): 309.402
Median insert size (absolute value): 241

So I suppose my reads from illumina hiseq are cleaned, and I got files without adaptors! Am I right?

Regards,
Siva

illumina hiseq reads adaptors
• 4,053 views • link
updated by Ram Ram • written by Siva • Siva

Oh and the mapping is good for the 100 bases, so I really supposed their is no adaptors...

HWI-ST1194:55:C11P5ACXX:4:2316:21329:100923     83      ScaffXRQ8f0000271       13416   55      101M    =       13340   -177    TAATTGTGTTAGGAAAATCTTTAGGTGGAGTGAAGATTTTAAGGGGCAAAAGCTACATTTGATGGCTGGCGAGTTGATATCGAAACTTGAGAACAAAGTAA    @A:5A>DDC@DCC>CCC>>>;;B@;;=3HE;FGGGG>@>C=2;8)IGIHCD<B?*ACGGBBG>HF<F<EHDHHECBFAGEJHHGGBC@FHBHFFFFFFCCC   NM:i:2  AS:i:91 XS:i:81 RG:Z:dnaseq0
• 0 views • link
updated by Ram Ram • written by Siva • Siva

2 answers

Before every analysis I run FastQC (per base sequence content) to visually inspect if there are any adapter sequences in my raw fastq.

• 0 views • link
updated by Ram Ram • written by PoGibas PoGibas

After to have run a fastqc I can see that "Adapter content" is green, but "per base sequence content" orange, but no prob I think. However "kmer content" is red and kmers which are most present are at the beginning : 1 to 15 bp.

It could be adapters?

Sequence,Count,PValue,Obs/Exp Max,Max Obs/Exp Position
AGAGCAC,71845,0.0,10.088463,9
TGCCGTC,54690,0.0,9.652958,48-49
• 0 views • link
updated by Ram Ram • written by Siva • Siva

Can you post per base sequence content image?

• 0 views • link
updated by Ram Ram • written by PoGibas PoGibas

This is ok, when there are adapters in the beginning of your reads you usually see ~100sequence content (in the image bellow 5 first bases are clearly adapter). To get better idea of your reads you can use --nogroup in fastqc.

< image not found >

• 0 views • link
updated by Ram Ram • written by PoGibas PoGibas

Great ! Thanks Pgibas :)

• 0 views • link
written by Siva • Siva

It this helped to answer your question, you can accept it :-)

• 0 views • link
written by PoGibas PoGibas

Hum actually I've seen this post: Finding Adapters For Illumina Reads

and that's why I haven't tried fastqc, because thought it will indicate me "adapter contamination" only and not default adapters used when making libraries.

I'll try fastqc, thanks Pgibas.

• 0 views • link
updated by Ram Ram • written by Siva • Siva

Log in to answer this question.

More posts like this