Looking for a short read mapping tool (Bioinformatics) based on Hadoop YARN

I'm looking for a bioinformatics tool which maps short reads to long references. I need a tool that is working on the Hadoop YARN framework. For the moment we are using CloudBurst (reads mapping tool) which is an Hadoop MapReduce 1 based and we need tool that is MapReduce 2 based (Hadoop Yarn).

Anybody has an idea?

hadoop mapreduce short read mapping yarn

• 1,881 views • link

written 11.3 years ago by benarnon •

0 answers

No answers yet.

More posts like this

Plotting marker location co-linearity between multiple physical and genetic maps
written 6.2 years ago by William

I am trying to plot the co-linearity of marker locations on multiple physical and genetic maps. I am not trying to improve the physical maps …
De-Novo Assembly pipeline on hadoop
written 11.8 years ago by chefarov

Hello all, I am planning to develop an De-novo assembly tool similar to Trinity which will make use of Hadoop framework. In order to do …
Absolute/Hapseg on Exome (WES) Data?
written 12.2 years ago by John St. John

I have recently gotten Absolute working with whole exome sequencing data, but I really wanted to use the information present in phasing allele specific copy …
Weighted Graph Matching In Bioinformatics
written 13.2 years ago by rein07 •

As we know that many problem in bioinformatics can be formulate into weighted graph matching problem. For example in <a href='http://bioinformatics.oxfordjournals.org/content/25/12/i259.short'>this paper</a> the author …
Is It Safe To Remove Exact Duplicate Reads In The Denovo Transcriptome Assembly?
written 13.3 years ago by lwc628

I use trinity/Oases for de novo transcriptome assembly. In my pipeline, I remove exact duplicate reads(forward and reverse strands) because I believe that duplicates don't …
Distributed Computing In Bioinformatics
written 13.3 years ago by Ngsnewbie •

As of now we have some Hadoop based packages (crossbow, cloudburst etc) for NGS data analysis, still I find tools like bowtie, tophat, SOAP etc …
Error When Calling Fusion Junctions With Mapsplice
written 13.8 years ago by David Langenberger

I try to call fusion junctions with MapSplice (1.15.2). My input reads are 100nt in length and in fastq format. Example: <pre><code>@xxxyyyzzz AGATGCACTACCACCCAGCCTATCAGGACAGGCCAAGCCTGAGGACAGTGACTGTCACAGAAAAATAGAAACTTGTGGTTCCAGGAAATCCGAGAGGTCT + IIHIHIHHIHHIHHGHHFGIGHGGGGIIIHHNKIJKIJELHCJFFGLIMLHLGLIAHBIEGFFDJQDAE>HIJHOIMLHAHGGHMPGHIFEJMDVJBEOM …
Best Existing Tool For Computing The Overlaps Between Each Read In A Set Of Short Reads?
written 14.1 years ago by Tianyang Li •

Hi, What is the best tool for computing the overlaps between each read in a set of short reads? For example, I have a set …
How To Output Postscript Using Dnaplotter?
written 14.1 years ago by GAO Yang

Hi, I am using <a href="http://www.sanger.ac.uk/resources/software/dnaplotter/">this tool</a> for some visualization work of my genome data, and want to get a high-solution plot result, say, 300dpi. …
Copy Number Variation (Cnv) Detection Using Single-End Sequencing Data
written 15.0 years ago by Doctoroots

Hi , does anyone know a tool for CNV detection that can work with single-end sequencing data? the current data im working on is one …