ABSOLUTE warning on cbs output

Hi,

I am running ABSOLUTE on a cbs input file without the maf option. I get the following warning:

In if (!is.na(res)) { ... :
the condition has length > 1 and only the first element will be used

I also get ploidy of an order of 7.(which is not expected) Can anyone help me with the warning ?

absoliute clonality purity maf

• 2,646 views • link

updated 4.2 years ago by Ram

• written 11.4 years ago by arshiaurora •

What are your arguments to RunAbsolute? If you are using segmented data from cbs, copy_num_type argument should be set to total.

• 0 views • link

updated 4.2 years ago by Ram

• written 11.4 years ago by poisonAlien

Parameter to copy_num_type is set to total only. Here are the rest of the parameters.

sigma.p <- 0
max.sigma.h <- 0.02
min.ploidy <- 0.95
max.ploidy <- 10

primary.disease<-"kidney"
platform<-'Illumina_WES'

max.as.seg.count <- 1500
max.neg.genome <- 0
max.non.clonal <- 0
copy_num_type <- "total"

min.mut.af<-0

• 0 views • link

updated 4.2 years ago by Ram

• written 11.3 years ago by arshiaurora •

0 answers

No answers yet.

More posts like this

absolute running error: Error in if (!is.na(res)) { : the condition has length > 1
written 2.7 years ago by qiuting •

The following are my R codes: ```r install.packages("numDeriv") BiocManager::install("DNAcopy") install.packages("ABSOLUTE_1.0.6.tar.gz",repos = NULL) library(numDeriv) library(ABSOLUTE) RunAbsolute( seg.dat.fn = "P01_1_GISTIC_segment", sigma.p = 0, max.sigma.h = 0.2, min.ploidy …
DESeq: obtaining DEGs from uneven dataset (some with replicates, some without)
written 7.4 years ago by exin

I'm trying to perform differential gene expression analyses using DESeq, on a pre-existing dataset, where 8 cell types (A to H) were identified from MARS-Seq …
Error in using ParsSNP
written 9.8 years ago by arsala521 •

Hello I want to use ParsSNP to identify driver mutations in the somatic mutation dataset of cancer. My input file is just like the sample …
How to obtain chi-square statistics for overlaps of three GRanges objects by pair-wise?
written 10.1 years ago by Jurat Shahidin

Dear all: I want to obtain chi-square statistics for following data by element wise. My apology to ask this statistical question from this community. However, …
All of the contigs from SOAPdenovo-trans are very short. I want to know the reason?
written 10.5 years ago by tigerhui587 •

Hello, I used SOAPdenovo-trans to assemble one transcriptome. But the contigs are very short, like this: >1 length 32 cvg_34.0_tip_0 CCACAGCGAGATCTGCCATTGGGAATCGCAAC >3 length …
How do I split a combined fastq file downloaded from SRA into separate _1.fq and _2.fq read pairs?
written 10.8 years ago by simonH •

I've downloaded a fastq file from SRA (http://trace.ncbi.nlm.nih.gov/Traces/sra/) containing reads from a paired-end Illumina 101 bp RNAseq experiment. The only problem is, it contains both …
Get Blast Database Size
written 12.8 years ago by PoGibas

I have piped unknown length sequences into <code>makeblastdb</code>. Now I want to know total length of those sequences (BLAST database size). Example: <pre><code> # "cat" …
Problem With Phastcons
written 13.0 years ago by vasilislenis

Hello everybody, I am trying to identify the conserved sequences between human, mouse and rut. I am using chromosome 22 of human as a reference …
Deseq - Problem With Plotma Function
written 13.4 years ago by Biomonika (Noolean)

I am now getting familiar with DESeq :-) I tried following code with passilla data from DESeq vignette: <pre><code> pasillaCountTable = read.table("passillaData", header=TRUE, row.names=1 ) …
Comparing Order Of Genes In Two Lists Using Orderedlist
written 14.6 years ago by Nasir •

Hi I would be very grateful for any suggestions on how to solve the following problem. I want to compare the order of genes in …