This is a test version of Biostars. For the public version, visit https://www.biostars.org.
GATK VariantRecalibrator error: Values for DP annotation not detected for ANY training variant

Hi,

I have another question related with GATK, specifically VariantRecalibrator in the INDEL mode:

$java -jar GenomeAnalysisTK.jar -T VariantRecalibrator -R Ref.fasta -input recal_snps.vcf -mode INDEL -recalFile indel.recal -tranchesFile indel.tranches -rscriptFile indel.recal.plots.R -resource:dbSNP,known=true,training=true,truth=true,prior=6.0 20M_filtered.vcf  -an DP -an MQ

INFO  21:59:32,158 HelpFormatter - --------------------------------------------------------------------------------
INFO  21:59:32,164 HelpFormatter - Program Args: -T VariantRecalibrator -R /home/bioinfo/data/genomes/rice/nipponbare_v7.0/index/bwa/Os_nipponbare_v7.0_genome.fasta -input all_chr_recal_snps.vcf -mode INDEL -recalFile all_chr.raw.indel.recal -tranchesFile all_chr.raw.indel.tranches -rscriptFile all_chr.indel.recal.plots.R -resource:dbSNP,known=true,training=true,truth=true,prior=6.0 /home/bioinfo/data/genomes/rice/nipponbare_v7.0/variations/20M_filtered/20M_filtered.vcf -an DP -an MQ
INFO  21:59:32,226 HelpFormatter - Executing as bioinfo@toro on Linux 2.6.32-358.23.2.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 1.7.0_51-mockbuild_2014_01_15_01_39-b00.
INFO  21:59:32,357 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 1000
INFO  21:59:32,502 GenomeAnalysisEngine - Preparing for traversal
INFO  21:59:32,505 GenomeAnalysisEngine - Done preparing for traversal
INFO  21:59:32,505 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING]
INFO  21:59:32,505 ProgressMeter -                 | processed |    time |    per 1M |           |   total | remaining
INFO  21:59:32,506 ProgressMeter -        Location |     sites | elapsed |     sites | completed | runtime |   runtime
INFO  21:59:32,509 TrainingSet - Found dbSNP track:     Known = true    Training = true         Truth = true    Prior = Q6.0
INFO  22:00:02,510 ProgressMeter -   Chr1:12909320    221975.0    30.0 s       2.3 m        3.4%    14.5 m      14.0 m
.....
.....
INFO  22:11:32,574 ProgressMeter -  Chr12:10944016   6647515.0    12.0 m     108.0 s       95.2%    12.6 m      35.0 s
INFO  22:12:02,577 ProgressMeter -  Chr12:26375047   6960773.0    12.5 m     107.0 s       99.4%    12.6 m       4.0 s
INFO  22:12:04,448 VariantDataManager - DP:      mean = NaN      standard deviation = NaN
INFO  22:12:16,628 GATKRunReport - Uploaded run statistics report to AWS S3
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR MESSAGE: Bad input: Values for DP annotation not detected for ANY training variant in the input callset. VariantAnnotator may be used to add these annotations. See http://gatkforums.broadinstitute.org/discussion/49/using-variant-annotator

Although I do have DP and MQ annotations for the indels in my input vcf (recal_snps.vcf). Here are some examples:

Chr1    11093   .       G       GACTCCCTCAGTGGTTTTGGAGGGTGGTTTCGCT      7666.65 .       AC=2;AF=1.00;AN=2;DP=129;FS=0.000;MLEAC=2;MLEAF=1.00;MQ=30.51;MQ0=0;QD=28.15        GT:AD:DP:GQ:PL  1/1:0,129:129:99:7696,526,0
Chr1    11100   .       T       TGTTGATCTGG     5820.65 .       AC=2;AF=1.00;AN=2;DP=121;FS=0.000;MLEAC=2;MLEAF=1.00;MQ=29.00;MQ0=0;QD=30.27    GT:AD:DP:GQ:PL      1/1:0,121:121:99:5850,391,0
Chr1    11194   .       T       TTTCTCC 4843.65 .       AC=2;AF=1.00;AN=2;DP=101;FS=0.000;MLEAC=2;MLEAF=1.00;MQ=37.97;MQ0=0;QD=29.72    GT:AD:DP:GQ:PL      1/1:0,100:100:99:4873,340,0

Also, it runs fine in the SNP mode with the exact same annotations. So, I don't know if it will help to run VariantAnnotator.

Here is how my dbSNP file looks like:

Chr1    1465    10100001465     A       G       .       PASS    .       GT      ./.     1/1     ./.     ./.
Chr1    1482    10100001482     C       T       .       PASS    .       GT      1/1     0/0     ./.     ./.     1/1
Chr1    1573    10100001573     T       C       .       PASS    .       GT      ./.     ./.     ./.     ./.     1/1

Please let me know what can I do to fix this.

Thanks and best regards,

Neil

gatk variantrecalibrator

Did you run VariantAnnotator on your vcf files?

How did you solve this error ? Did you run VariantAnnotator on this one ?

0 answers

No answers yet.

Log in to answer this question.