This is a test version of Biostars. For the public version, visit https://www.biostars.org.
transcription factor binding site prediction software/server

Hi,

I have a DNA sequence (fasta file format), I would like to predict transcription factor binding site (TFBS) and ribosomal binding sites (RBS).

Is there an easy software/server which predicts TFBS and RBS.

I tried to use R package for TFBS prediction using biocLite("JASPAR2014"), but I don't understand it.

Best!

Shashank

sequence genome-sequencing

This is the prokaryotic sequence, and I need to find the TFBS and RBS, above-mentioned software doesn't work.

AACTCTGAGATATTGACTTGAAGCATTTCATAAAGTTCAATGTTCAAATCTCAAAGTTCAAAGTTATTTATTCGTCTCTCATTGCATCTACCGGCTTGATGCTCATGGCTCGCCAGGCTGGGGCAAGTCCGGCTAGGCCGCCAAGGATGCAGATGAGGATGGCTGAAGAGATGGCCGTCCAGAAATCTACCTGGAAATGGGCGGTGAGAATGCCATCCGTGGTGTTCGCCATCTCCAGCATCTGCAGGATGGCTACTCCGAAGATGATGCCGCTCATGCCTGCCACCAGGGTGAGGAGAATACTCTCTGAGATGATTTGCGAGAGAATCATCTTCGGCGTGGCGCCGATGGCTCGGCGAATGCCTATCTCGGTGGTTCGCTCCTTCACCGTTACCATCATGATGTTGGAAACTCCGATGGCGCCGGCGAGAAGGGTGCCGATACCTACCAGCCAGATGAGGAAGTTGACGCCCTTAAACAGATTGTCGAGCATCTGGAAGAGCACCTCCGTATTGAACACCATGATTCCCTTTTCATCTGAAGGGTCGATGTTATGGGCCCTGGCTATGGTTTCACGCATTCGCTGGGCGATGTTGCTCATCACTACGCCCGGCTTACCGGTGGTGGCGATGATGTCGATGGCGGTTCCGCGGTTGTAG

If the free help you're given doesn't meet your needs, please do a better job of communicating why and how those options do not work.

Prediction Aviator

4 answers

It depends which organism are you working with.

Following these links you can find useful tools:

You can also look at Virtual Footprint, "It was especially designed to analyze transcription factor binding sites in whole bacterial genomes and their underlying regulatory networks."

I have a prokaryotic sequence. Does the above mentioned link work for it?

You should report a bit more in detail what you want to do. I think Virtual Footprint can help you, see my edit.

mapper worked fine for me.

I have a prokaryotic sequence, so I don't think MAPPER is gonna work.

You can use Genome Compiler - they have embedded into their software the RBS Calculator by Prof. Howard Salis.

Here are some helpful articles and tutorial video: How to use, Q&A with Salis, Tutorial video.

You can use weight matrices or SITECON to predict TFBS in UGENE.

Log in to answer this question.