Hi I am trying to use a small RNA data from CD34 bone marrow cells to compare with another private data that I have.
I just downloaded it from SRA (sra id: SRR772115) and converted it using fastq-dump. But the results don't look typical of a fastq file. Since each read in fastq file is represented in 4 lines while here its not the case. Here is how the converted fastq file looks like.
@SRR772115.1 FCC0B8BACXX:8:1101:1416:2034 length=49
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATG
+SRR772115.1 FCC0B8BACXX:8:1101:1416:2034 length=49
bbbeeeeeggggghhiiiiihiiiiiiiiggfhicfghihhiiihhhii
@SRR772115.2 FCC0B8BACXX:8:1101:1317:2047 length=49
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATG
+SRR772115.2 FCC0B8BACXX:8:1101:1317:2047 length=49
bbbeeeeegggggghiiiiiiiiiiiiiiihiiicgghhghhiiiihih
@SRR772115.3 FCC0B8BACXX:8:1101:1437:2047 length=49
TATGGTCGCAAGGCTGAAACTTAAAGAAATTGATGGAATTCTCGGGTGC
Can anybody tell me if I am missing something here. And how to get the fastq in proper format.
regards
2 answers
It does look like well formatted FASTQ, albeit with a bit of an odd encoding. You can use this to find the encoding: https://github.com/brentp/bio-playground/blob/master/reads-utils/guess-encoding.py
@SRR772115.1 FCC0B8BACXX:8:1101:1416:2034 length=49 #ID
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATG #Seq
+SRR772115.1 FCC0B8BACXX:8:1101:1416:2034 length=49 #ID
bbbeeeeeggggghhiiiiihiiiiiiiiggfhicfghihhiiihhhii #Qual
@SRR772115.2 FCC0B8BACXX:8:1101:1317:2047 length=49
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATG
+SRR772115.2 FCC0B8BACXX:8:1101:1317:2047 length=49
bbbeeeeegggggghiiiiiiiiiiiiiiihiiicgghhghhiiiihih
@SRR772115.3 FCC0B8BACXX:8:1101:1437:2047 length=49
TATGGTCGCAAGGCTGAAACTTAAAGAAATTGATGGAATTCTCGGGTGC
...
...
What do you think is wrong with it? These reads look, and FastQC agrees:
##FastQC 0.10.1
>>Basic Statistics pass
#Measure Value
Filename temp.fq
File type Conventional base calls
Encoding Illumina 1.5
Total Sequences 2
Filtered Sequences 0
Sequence length 49
%GC 53
It repeats the read name on the quality line (+) as well as the nucleotide line (@), but that's fine.
Log in to answer this question.