Thank you for the quick response. I do not have the original fastq files. I only got the processed fasta files. I can try remove the @ with sed. Thank you
converting sam to bam format samtools
Hello
This is my first time runing bwa and samtools. I am not so similar with the terminology.
I have generated sam file with the command:
bwa sampe ref.fa aln_sa1.sai aln_sa2.sai read1.fq read2.fq > aln-pe.sam
The read files are actually files that were processed by the servicing lab and have only unique reads. they look like this:
>@SBS123:70:B0563ABXX:3:1101:1246:2041 1:N:0:GCCAAT
NTAAGGCTACCTAAAGGAGCTCATGCANCATTANCTATGGTANTTGTCATCTTCACTTTGTACAGTACTGCAGCATTGGGTCAGCTCTTCTTTTTCCATGT
The sam file head looks like this:
@SQ SN:UCW_Tu-k45_contig_21575;tu-k61_contig_17060 LN:1805
@SQ SN:UCW_Tu-k25_contig_8865;tu-k31_contig_8795 LN:3898
When I run:
samtools view -bS aln.sam > aln.bam
I get this message:
[sam_header_line_parse] expected '@XY', got [@SBS123:70:B0563ABXX:3:1101:1206:2056 83 UCW_Tu-k41_contig_1687 3010 60 101M = 2977 -134 CTGATGACCCATGTGTGATGAACAGCTACCTCTTTGTTCAAGAGCTAGTGATGGAGCTAGAAATGTCNACTTGTAGTGTAAGTTGGCAAAATGACTGCTTN * XT:A:U NM:i:5 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:5 XO:i:0 XG:i:0 MD:Z:1C8T56C2A29T0]
Hint: The header tags must be tab-separated.
[samopen] no @SQ lines in the header.
[sam_read1] missing header? Abort!
Any suggestions are welcome
Thank you
• 5,047 views
•
link
1 answer
It looks like your aligner didn't remove the @ signs from in front of the read names! That'll cause the problem you're seeing. Can you show the first read in the fastq file?
• 0 views
•
link
• 0 views
•
link
Log in to answer this question.
can you please show us the output of 'head -n 20 aln-pe.sam'
Thank you for the quick response. The next 20 lines will look the same as the first two. I forgot to say this is Rseq analysis against 88000 transcriptome contigs.
Hello
The problem was solved by removing the @ signs from the reads in the aln.sam file. I did it with the command
Thank you for your help