This is a test version of Biostars. For the public version, visit https://www.biostars.org.
converting sam to bam format samtools

Hello

This is my first time runing bwa and samtools. I am not so similar with the terminology.

I have generated sam file with the command:

bwa sampe ref.fa aln_sa1.sai aln_sa2.sai read1.fq read2.fq > aln-pe.sam

The read files are actually files that were processed by the servicing lab and have only unique reads. they look like this:

>@SBS123:70:B0563ABXX:3:1101:1246:2041 1:N:0:GCCAAT
NTAAGGCTACCTAAAGGAGCTCATGCANCATTANCTATGGTANTTGTCATCTTCACTTTGTACAGTACTGCAGCATTGGGTCAGCTCTTCTTTTTCCATGT

The sam file head looks like this:

@SQ     SN:UCW_Tu-k45_contig_21575;tu-k61_contig_17060  LN:1805
@SQ     SN:UCW_Tu-k25_contig_8865;tu-k31_contig_8795    LN:3898

When I run:

samtools view -bS aln.sam > aln.bam

I get this message:

[sam_header_line_parse] expected '@XY', got [@SBS123:70:B0563ABXX:3:1101:1206:2056    83    UCW_Tu-k41_contig_1687    3010    60    101M    =    2977    -134    CTGATGACCCATGTGTGATGAACAGCTACCTCTTTGTTCAAGAGCTAGTGATGGAGCTAGAAATGTCNACTTGTAGTGTAAGTTGGCAAAATGACTGCTTN    *    XT:A:U    NM:i:5    SM:i:25    AM:i:25    X0:i:1    X1:i:0    XM:i:5    XO:i:0    XG:i:0    MD:Z:1C8T56C2A29T0]
Hint: The header tags must be tab-separated.
[samopen] no @SQ lines in the header.
[sam_read1] missing header? Abort!

Any suggestions are welcome

Thank you

samtools sam bam

can you please show us the output of 'head -n 20 aln-pe.sam'

Thank you for the quick response. The next 20 lines will look the same as the first two. I forgot to say this is Rseq analysis against 88000 transcriptome contigs.

Hello

The problem was solved by removing the @ signs from the reads in the aln.sam file. I did it with the command

sed -i 's/@SBS/SBS/g' aln.sam

Thank you for your help

1 answer

It looks like your aligner didn't remove the @ signs from in front of the read names! That'll cause the problem you're seeing. Can you show the first read in the fastq file?

Thank you for the quick response. I do not have the original fastq files. I only got the processed fasta files. I can try remove the @ with sed. Thank you

Log in to answer this question.