Custom Genome - How to replace string with a new string based on coordinates · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Custom Genome - How to replace string with a new string based on coordinates

Hi,

I am currently building a custom genome where I am replacing 16 regions (50-300kb) with 16 regions of new sequence. What is the most efficient way of doing this? I have the coordinates of all regions in each chromosome where I want to paste the new sequence into and I have the files of the new sequences in .txt format.

Can you please advise?

Thanks

chip-seq assembly index genome

• 1,864 views • link

updated 4.5 years ago by Ram

• written 11.7 years ago by josephmccarter1

0 answers

No answers yet.

Log in to answer this question.

More posts like this

Database or Tool: Identifying Gene Regions (Exon/Intron/UTR) from Chromosome Position
written 2.3 years ago by kelpotus22 •

I'm currently using the BioMart database to identify genes and regulatory elements based on chromosome and position coordinates. However, I'm also interested in determining whether …
Is there a way to get RNAFold output for multifasta in tabular format?
written 6.9 years ago by adhirajnath14 •

I am trying to calculate the MFE along with the secondary structure for multifasta using RNAFold. The output generated is of the format. <pre>>abc GGCGGAGGUAGGGAGGCACGCGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAG …
genes upstream or downstream of a LNcRNA
written 7.7 years ago by EpiExplorer

Hi I have the list of LncRNAs of interest and their coordinates in BED format. I am interested in identifying the protein coding genes that …
chromosome coordinate, rs
written 7.9 years ago by Ebtihal Kamal •

hello every one , I am new in bioinformatics i need to analyze my SNPs by SIFT the required format chromosome coordinates i have rs …
comparing 2 long BED files in R in an efficient way
written 8.1 years ago by Bogdan

Dear all, please would you advise about an efficient R code to solve the following problem : -- given a BED file with the variant …
From read counts to genotypes, or even better, a vcf
written 8.2 years ago by Joanna.ilska •

Hi all, I am fairly new to dealing with sequence data and have come across a problem which I am not entirely sure how to …
Identifying CNVs from targeted amplicon sequencing
written 8.2 years ago by kvn95ss •

I have few unmatched samples which have been sequenced with targeted amplicon sequencing using a custom library which covers a small segment of a chromosome …
finding function of genes from their coordinates
written 8.6 years ago by Ana

Hi everyone, I made some Manhattan plots and I can see some very tall peaks on chromosome 6 and 12. I already have the coordinates …
Retrieving Genomic Sequence Based On Coordinate Information From Annotation File
written 12.6 years ago by es55spam •

I have a large FASTA file (a genetic sequence, an entire chromosome), where each line contains 50 characters (bases a,g,t, and c). There are about …
Best Approach For Designing Sureselect Custom Capture Baits In A Ngs Snp Study
written 15.3 years ago by Travis

<p>Hi All, </p> <p>If designing a custom capture array for a subset of genes to sequence in an NGS/SNP study, does it make sense to …