This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Extraction Of Part Of Different Grp Of Nucleotide Sequence In 10000 Of Sequences.

Hi

I would like to extract particular reason in the 1000 contigs.For example I am having 10000 sequences as a contig and each sequence file having 5000 nucleotide base pair. Suppose contig one is having 1000 base pair and i want to extract 1-200 , 251-456, 500-609 and others so in this way I am having 1000 of ranges and I want to extract in all 10000 sequences. I also want to store these file in new file .

extraction sequence

I would like to elaborate it....

contig00001 length=24020 numreads=1501 TCCTTAAGAATGTCTTCAATACAATCTTTTTGGATTGATTTTGTCAAATCAACCAGGAAA TTTTCCATGTCTTCCAAACCTTGCTCTACAAAGATTATTTTTCCAATGAACAACATCAGC CTTGATACCCACTTCATATGATGAGATTCTGTTATCAAAATTATACTTACCTTGCAAATA TGATGTGAATTTTTTGTGTTGTGATTCACCAATCCCAGAATCCATGGATCTCAAATTTGA

and

I want to exaract 1-50, 61-250, 255-699 sequences from this file. In this way I am having 1000 file and 1000 of pattern.

Any suggestion related with it is welcome.

Think you need to be more specific on you use case (what do you exactly want to do). The contig file is clear but what and how do you get/store the ranges? Or do you need to find these first as well by mapping of another set of sequences?

1 answer

sounds like a job for EMBOSS extractseq

 extractseq tembl:x65921 -reg "782..856,951..1095,1557..1612,1787..1912" stdout

If you really have many regions, you can also specify a regions file with '-regions @myfile'

Log in to answer this question.