This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Fastafrombed Problem

hi,

I try this tools from BedTools but it doesnt work!

$ cat testgenome404.fa

>chr1
AAAAAAAACCCCCCCCCCCCCGCTACTGGGGGGGGGGGGGGGGGG

$ cat test.bed
chr1    5       10

$ ./fastaFromBed -fi testgenome404.fa -bed test.bed  -fo test.fa.out

**index file testgenome404.fa.fai not found, generating...

unable to find FASTA index entry for 'chr1'**

$ cat testgenome404.fa.fai
chr1    46      7       46      47

what is this file "testgenome404.fa.fai" what does means this number? chr1 46 7 46 47

why this message?

unable to find FASTA index entry for 'chr1'

Thanks in advance for any help Sara

bedtools bed fasta conversion
• 8,205 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by Sara • Sara

Is it possible that you have an extra space after 'chr1' in your fasta file?

• 0 views • link
written by Aaronquinlan Aaronquinlan

no it is not possible i check it but there is still the same problem

• 0 views • link
written by Sara • Sara

Please try the verion in the latest release (2.13). If you were using a version from the dev. repository, this may fix your issue.

• 2 views • link
written by Aaronquinlan Aaronquinlan

1 answer

The fai is an index for the sequences contained in a fasta file.This kind of index helps the programs to quickly retrieve a (sub)sequences for a given region.

It seems that your tool automatically generated it as it didn't exist.

Each line in this file contains:

  • the name of the sequence
  • the length of the sequence
  • the offset of the first base in the file
  • the number of bases in each fasta line
  • the number of bytes in each fasta line

so, if you want to get the base at index "beg" for the sequence defined in "val", the program will seek the following offset (code from samtool):

val.offset + beg / val.line_blen * val.line_len + beg % val.line_blen

Note: A faidx can be generated with samtools faidx

• 187 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Log in to answer this question.

More posts like this
  • problem with bedtools getfasta
    written by anasjamshed anasjamshed
    I am trying this code from bedtools getfasta manual: $ cat test.fa >chr1 AAAAAAAACCCCCCCCCCCCCGCTACTGGGGGGGGGGGGGGGGGG $ cat test.bed chr1 5 10 $ bedtools getfasta -fi test.fa …
  • Trouble with bedtools getfasta
    written by gkunz • gkunz
    I am trying to extract sequences from a .fasta file based on a bed file using bedtools getfasta and I am getting the following error. …
  • extract entire header from BED file to FASTA
    written by amitpande74 • amitpande74
    Hi, Is there any way one can extract the entire header from a BED file while using `bedtools getfasta` command and write it in the …
  • bedtools getfasta for mm9 genome
    written by rishi • rishi
    I downloaded the mm9 genome (all chromosomes) from UCSC (http://hgdownload-test.cse.ucsc.edu/goldenPath/mm9/chromosomes/) , and then concatenated them using the following code: cat chr1.fa | cat - chr2.fa …
  • How To Melt A Bed File (With Bedops?)
    written by Irsan Irsan
    <p>Consider the following bed entries</p> <pre><code>chr1 10 13 chr2 100 103 </code></pre> <p>Is it possible to melt this 2-record bed file to a bed where …
  • How To Get Fasta Format Using Fastafrombed Or How To Turn Linearized Fasta To The Same Length Colum…
    written by PoGibas PoGibas
    <p>I extracted sequences with fastaFromBed and have no complains about the BEDTools which is really awesome thing.</p> <p>Otherwise extracted sequences look like this:</p> <pre><code>&gt;chr19:13985513-13985622 GGAAAATTTGCCAAGGGTTTGGGGGAACATTCAACCTGTCGGTGAGTTTGGGCAGCTCAGGCAAACCATCGACCGTTGAGTGGACCCTGAGGCCTGGAATTGCCATCCT …
  • Bedtools "Segmentation Fault" While Working With Genome.Fa
    written by PoGibas PoGibas
    <p>I wanted to use <a href='https://code.google.com/p/bedtools/'>BEDTools</a> to extract genomic sequences (fastaFromBed).</p> <p>My BED file has all 24 chromosomes, hence I want to use whole genome …
  • How Can I Merge Intervals ?
    written by Mchimich • Mchimich
    <p>Hello everybody, I should be grateful if you would kindly help me de fix my problem. I have a table like that :</p> <pre><code>Chromosome start …
  • Merge Fasta According The Beginning Of The Name
    written by PoGibas PoGibas
    <p>I have thousands of <code>.fa</code> files in a directory. Names are:</p> <pre><code>ch14.fa_20452_206652_15-84.fa ch14.fa_20452_206652_786-14.fa ch14.fa_20452_206652_77-85.fa ch14.fa_20452_206652_81-78.fa ch2.fa_16903_17204-41-44.fa ch2.fa_16903_17204-2-46.fa ch2.fa_16903_17204-61-47.fa ch2.fa_16903_17204-73-52.fa </code></pre> <p>I want to merge files …
  • Is Makeblastdb Creat 3 Files Like Formatdb + Blast Error
    written by Sara • Sara
    <p>Hi everyone, </p> <p>I have a big problem!</p> <p>I install blast+ for windows.</p> <p>I run this :</p> <pre><code>makeblastdb.exe -in filename.fasta -dbtype nucl -out filename_BLASTdb </code></pre> …