Hello I have a miRdeep2 mapper output and I am confused by its description.
The command I ran is:
mapper.pl *S1_L001_R1_001.fastq -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p ensembl_genome.fa -s S1_reads_fastq.fa -t S1_ensembl.arf -v
The output summary file is:
mv: cannot move `mapper.log' to `mapper.log_bak': No such file or directory
parsing fastq to fasta format
converting rna to dna alphabet
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
# reads processed: 64477
# reads with at least one reported alignment: 22453 (34.82%)
# reads that failed to align: 39152 (60.72%)
# reads with alignments suppressed due to -m: 2872 (4.45%)
Reported 30211 alignments to 1 output stream(s)
trimming unmapped nts in the 3' ends
cat: mapper.log_tmp: No such file or directory
cat: mapper.log_bak: No such file or directory
rm: cannot remove `mapper.log_tmp': No such file or directory
rm: cannot remove `mapper.log_bak': No such file or directory
Mapping statistics
#desc total mapped unmapped %mapped %unmapped
total: 1222343 1009414 212929 0.826 0.174
seq: 1222343 1009414 212929 0.826 0.174
What I don't understand is: the difference between
the alignment rate
# reads with at least one reported alignment: 22453 (34.82%)
# reads that failed to align: 39152 (60.72%)
and
the last two rows mapped %: 0.826 and 0.174.
How to interpret these results? What these two values mean here? Thank you!
You'll need to paste the command you issued. There are multiple ways to run miRdeep2 and I suspect that the 34.82% and 60.72% metrics are from different steps in the pipeline.
thanks Devon!
Here is the command I used: