Indel and missing in mach phased output
In mach phased output, how does it represent missing genotypes and indels?
mach
indel
genetics
imputation
• 2,103 views
•
link
updated
by
Ram
4.5K
• |
written
by
kindlychung
6
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
convert beagle genotypes to vcf
written by bsp017 5Hi, I have a phased beagle file which I generated through Angsd v0.935. I would like to use the beagle utility program beagle2vcf.jar. However I …
-
phasing VCF files with missing genotype
written by summerday1112 1I want to phasing a VCF file with missing value(./.), the output I want get (a VCF also)is all the genotype are phased, but the …
-
Split phased haplotypes of same person coming from same parents
written by Parham 160Hi, I have phased haplotypes of two samples from same person. However, since they are coming from malignant and healthy tissue, the genotypes might slightly …
-
Phased genotypes data per population
written by nastasia 1Hello everyone, I am looking to the phased genotypes for hapmap data per population (like YRI, CEU, JPT...). I know that the plink and hapmap …
-
Phasing genotype likelihood data and merging them with phased genotype calls data.
written by Mr Locuace 18I have 3 sets of genotypes: 1. A multiethnic panel of phased 1000G Phase 3 genotypes in IMPUTE2 format (.hap). 2. Genotype likelihoods (GL) for …
-
Set as missing for some of genotypes of an individual
written by minajhun 0Hi, I would like to set some of genotypes (includes SNPs and INDELs) as missing for an individual in a data of 20,000 samples. I …
-
Convert Impute2 phased output files to mach format
written by kindlychung 6I am trying to convert some files from impute2 phased output (haps files), Most of the lines look like this: ``` --- SNP BP A1 …
-
how can I make input file for Haploview from Output files of inferred haplotypes by fastPHASE?
written by mary 21Dear all I am doing LD analysis and selection signature on 50k snp data of cattle. For the analyses, fully phased haplotype data were required. …
-
Phased And Imputed Genotypes For Hapmap Samples With Plink Format
written by J.F.Jiang 93<p>Hi all,</p> <p>I am looking for the phased and imputed genotypes for hapmap samples with plink format. Although I can download the raw genotypes from …
-
No T In Prephased Mach Output File
written by kindlychung 6<p>I just got some prephased genotype data, which is said to be the output of MaCH, and looks like this:</p> <pre><code>RS1->2001 HAPLO1 AAACAAGGAGGAGAAGGAAA ... RS1->2001 …