This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Automating UCSC's BLAT

I do not want to use command line BLAT.

It cannot detect inserts. I have written scripts that can extract information in HTML files, but I had the urls.

I want to automate a web query script that can send fasta queries to UCSC's website. Then parse out alignments in the top matches. See picture of insert below.

Does anyone know a way to accomplish this using perl, python, java, or R?

blat ucsc web-query

Accomplish what? This is hardly intelligible, please rephrase.

1 answer

Please elaborate your question a little, but I think you can achieve what you want using the Ruby mechanize library.

require 'mechanize'
a = Mechanize.new
url = 'http://genome.ucsc.edu/cgi-bin/hgPcr?command=start'
page = a.post(url, {"wp_f" => 'AAGTCTTCATATCATCCTTGTT', "wp_r" => 'GTAGCTGAACTTGGTTCTTTC'})
puts page.body
puts page.link_with(:href => /hgPcrResult/).href

Please note that UCSC has a poicy against extended use of automated queries: hitting it too hard might get your IP banned.

Log in to answer this question.