This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Prepare file for Multiple alignment

Hi everyone,

What I need to do is I need multiple sequence alignment file

I converted the vcf file to consensus fasta and cat all these consensus sequence into multifasta.

In my cat file seq are >1......>10000 for a.fasta and >1......>10000 for b.fasta when I use clustalw it gives error that sequence have same header THAT MAKES SENSE so what I am planning to do is to convert >1......>10000 to >1 and >1......>10000 for b.fasta to >2 and same for for all my 5 samples

Guide me with command to do that

Please do suggest any help

Regards

next-gen
• 5,131 views • link
updated by Ram Ram • written by Tark • Tark

So a.fasta contains 10000 sequences with headers 1, 2, 3, .... 10000 and b.fasta contains 10000 sequences with headers 1, 2, 3, .... 10000? You have 5 fasta files like that (a, b, c, d, e) and you want to combine them to a single file keeping their identity, right? It is easy, just change the header in each file and combine them using cat:

sed -i 's/^>/>A_/g' a.fasta
sed -i 's/^>/>B_/g' b.fasta
sed -i 's/^>/>C_/g' c.fasta
sed -i 's/^>/>D_/g' d.fasta
sed -i 's/^>/>E_/g' e.fasta

cat a.fasta b.fasta c.fasta d.fasta e.fasta >> combined.fasta

(If you want to use numbers instead of letters, substitute letters with numbers in the above sed commands)

• 0 views • link
updated by Ram Ram • written by arnstrm arnstrm

Thank you let me try and see whether it answers my problem

• 1 views • link
updated by Ram Ram • written by Tark • Tark

Can you suggest me how I can combine

a.fasta with 10000 sequences having headers 1, 2, 3, .... 10000 .......................into just one header e.g

>1
AAATTTTGGGGCCC
>2
ACCCCGGGTTT
..........
>10000
ATGCCCCCCCCCC

>1
AAATTTTGGGGCCCACCCCGGGTTTATGCCCCCCCCCC

Please suggest

• 2 views • link
updated by Ram Ram • written by Tark • Tark 
cat <(head -n 1 a.fasta) <(grep -v ">" a.fasta | tr -d "\n") > output.fasta

Concatenate

1. the first line of a.fasta

and

2. all the lines of a.fasta that don't have a ">" with line-breaks deleted

• 2 views • link
updated by Ram Ram • written by 5heikki 5heikki

Thanks let me try this

I understand first part but what does this mean

tr -d "\n"
• 2 views • link
updated by Ram Ram • written by Tark • Tark

to remove the new line character

• 2 views • link
updated by Ram Ram • written by Sam Sam

Thank you

I did as directed now I have file with one header e.g

>A_1
GGATGCCCAGCTAGTTTGAATTTTAGATAAACAACGAATAATTTCGTAGCATAAATATGTCCCAAGCTTAGTTTGGGACATACTTATGCTAAAAAACATTATTGGT

I did this with two files

>B_1
GGATGCCCAGCTAGTTTGAATTTTAGATAAACAACGAATAATTTCGTAGCATAAATATGTCCCAAGCTTAGTTTGGGACATACTTATGCTAAAAAACATTATTGGT

Now I want to combine them when I did I get

cat a.fasta b.fasta >> combined.fasta

When I want to check both come in one file or not I did

grep -c "^>" combined.fasta

It gives 1. My question is why not 2?

And when I upload this multifasta file on galaxy for multiple alignment it gives badly formatted file error

Please help

• 1 views • link
updated by Ram Ram • written by Tark • Tark

1 answer

It's because there are no \n at the end of the sequences. In your combined fasta >B_1 is next to the last nucleotide of >A_1 sequence, i.e. there's only one line that begins with > (grep -c "^>"), grep -c ">" would return 2. To avoid this you can for example awk '{print}' a.fasta b.fasta > combined.fasta. Also, it is generally a good idea to use > instead of >> because >> appends.

Edit. meant to post as a comment

• 2 views • link
updated by Ram Ram • written by 5heikki 5heikki

ok thank you

• 2 views • link
written by Tark • Tark

Thank you it (awk '{print}' a.fasta b.fasta >combined.fasta) was good.

Can I ask you one question not related to this

I have to count number of bases in fasta file and using this command

grep -v ">" a.fasta | wc | awk '{print$3-$1}'

I know this command is correct as it gives me same result on galaxy

can you explain what $3-$1 means

I saw on awk manual that $ is for column and - for subtraction but in fasta file we don't have columns so how to understand

• 0 views • link
updated by Ram Ram • written by Tark • Tark

Log in to answer this question.

More posts like this