This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Plant miRNA prediction

Hi everyone

I am doing a next gen sequencing project to identify miRNA in brassica. I made the small RNA libraries and sent them for sequencing and subsequent analysis. The data that I got back shows a lot of novel miRNAs and also some novel miRNAs with similarity to already known miRNAs in miRbase. For eg. aaaacggaaucguaagcuuc is called similar to osa-miR2121a (whose sequence is aaaacggagcgguccauuagcgcg). The similarity between these two miRNAs is between 2-8nt. Same criteria is for other miRNAs.

My question is how should I interpret this data? When doing clustering of miRNAs in families which sequence should I use? I think similarity at seed region can not be used as a criteria for clustering!

I would welcome any kind of suggestions.

Thanks

mirna plant next-gen
• 3,156 views • link
updated by Ram Ram • written by swati25887 • swati25887

1 answer

By clustering miRNAs, do you mean assigning these to a specific miRNA family based on sequence identity? In case of plants, usually mature miRNAs are assigned to the same family based on perfect or near-perfect sequence matches (allowing 0-4 mismatches according to Meyers et al., 2008 paper).

• 0 views • link
updated by Ram Ram • written by Saima • Saima

Log in to answer this question.

More posts like this