This is a test version of Biostars. For the public version, visit https://www.biostars.org.
BioPerl script getting hung up and running very slowly.

Hey guys, I've been trying to figure out why this script has been running painfully slowly. It takes a 256 GB node about 14 hours to produce 3051 results, which definitely shouldn't be the case. I was hoping you guys could look at it and see if a) any of the changes I've made are screwing it up and b) if there's anywhere it could be doing something superfluous that is causing it to take so very long. We've done much more intense things much more quickly so it definitely shouldn't be taking this long, so it's almost certainly a problem with the script:

#!/usr/bin/env perl
###############################################################################
#
#    calc.dnds.pl
#
#     Calculates pairwise dn/ds ratios of all input sequences. Note: the sequences
#     have to be alligned and in fasta format. In addition its assumed they start in
#    frame.
#    
#    Copyright (C) 2012 Mads Albertsen
#
#    This program is free software: you can redistribute it and/or modify
#    it under the terms of the GNU General Public License as published by
#    the Free Software Foundation, either version 3 of the License, or
#    (at your option) any later version.
#
#    This program is distributed in the hope that it will be useful,
#    but WITHOUT ANY WARRANTY; without even the implied warranty of
#    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
#    GNU General Public License for more details.
#
#    You should have received a copy of the GNU General Public License
#    along with this program.  If not, see <http://www.gnu.org/licenses/>.
#
###############################################################################

#pragmas
use strict;
use warnings;

#core Perl modules
use Getopt::Long;

#Bioperl modules
use Bio::Seq;
use Bio::AlignIO;
use Bio::Align::DNAStatistics;
use Bio::SeqIO;

#locally-written modules
BEGIN {
    select(STDERR);
    $| = 1;
    select(STDOUT);
    $| = 1;
}

# get input params
my $global_options = checkParams();

my $inputfile;
my $outputfile;
my $tempheader;
my %header;
my %sequence;
$inputfile = &overrideDefault("inputfile.txt",'inputfile');
$outputfile = &overrideDefault("outputfile.txt",'outputfile');

######################################################################
# CODE HERE
######################################################################

### declare 2 position variables for sequences to compare (to be incremented by 2 each loop)
my $i1 = 1;
my $i2 = 2;

# use Bio::AlignIO to read in the alignment
my $str = Bio::AlignIO->new('-file' => $inputfile);                                                #To get the length of the sequences. (Assumes that tey are all equal length)
my $aln = $str->next_aln();

my $seqlength = $aln->length/3;

my $stats = Bio::Align::DNAStatistics->new();                                                      #Create the stats variable.
my $in = Bio::AlignIO->new(-format => 'fasta', -file => $inputfile);                               #Add the input fasta file.
my $alnobj = $in->next_aln;

### open file specified in command line for writing (if omitted on command line, "output.txt" will be used.
open (MYFILE, '>>'.$outputfile);

### print column headers one time at top of output. move inside loop to print above each individual result
print MYFILE "comparison\tAA.length\tdN/dS\t#dN\t#dS\t%AA.sim\n";

### start loop using total pairs of sequences to be compared from getpairs sub as number of times to loop

for (my $i=1;$i<=972793;$i++){
    my $alnobj2 = $alnobj->select($i1, $i2);                                                                        #Add objects that need to be aligned. By taking each sequence from the in file one by one.
    my ($seq1id,$seq2id) = map { $_->display_id } $alnobj2->each_seq;
                                   #create the combinations of sequences that need to be compared.

    ### changed from calc all stats to only one pair
    my $results = $stats->calc_KaKs_pair($alnobj2,$seq1id,$seq2id);                                                #Calculate all stats.
    my %Nd;
    my %Sd;

    for my $an (@$results){                                                                            #Get the results that are needed for the output
        for (sort keys %$an ){
            next if /Seq/;
            if ($_ eq "N_d"){
                my $tempcomp = $an->{'Seq1'}." vs ".$an->{'Seq2'}; 
                $Nd{$tempcomp} = $an->{$_};
            }
            if ($_ eq "S_d"){
                my $tempcomp = $an->{'Seq1'}." vs ".$an->{'Seq2'}; 
                $Sd{$tempcomp} = $an->{$_};
            }        
        }

    foreach my $key (sort keys %Nd){    
        my $tempcalc2 = (1-$Nd{$key}/$seqlength)*100;
        print MYFILE "$key\t$seqlength\t",sprintf("%.2f","\t",sprintf("%.0f",$Nd{$key}),"\t",sprintf("%.0f",$Sd{$key}),"\t",sprintf("%.1f",$tempcalc2),"\n";    
    }

    ### increment positions to next pair
    $i1 = $i1 + 2;
    $i2 = $i2 + 2;
}

### close output file handle
close (MYFILE);

######################################################################
# TEMPLATE SUBS
######################################################################
sub checkParams {
    #-----
    # Do any and all options checking here...
    #
    my @standard_options = ( "help|h+", "inputfile|i:s", "outputfile|o:s");
    my %options;

    # Add any other command line options, and the code to handle them
    # 
    GetOptions( \%options, @standard_options );

    #if no arguments supplied print the usage and exit
    #
    exec("pod2usage $0") if (0 == (keys (%options) ));

    # If the -help option is set, print the usage and exit
    #
    exec("pod2usage $0") if $options{'help'};

    # Compulsosy items
    #if(!exists $options{'infile'} ) { print "**ERROR: $0 : \n"; exec("pod2usage $0"); }

    return \%options;
}

sub overrideDefault
{
    #-----
    # Set and override default values for parameters
    #
    my ($default_value, $option_name) = @_;
    if(exists $global_options->{$option_name}) 
    {
        return $global_options->{$option_name};
    }
    return $default_value;
}

sub getpairs
{
my $seq_in  = Bio::SeqIO->new(
                              -format => 'fasta',
                              -file   => $inputfile,
                              );

# loads the whole file into memory - be careful
# if this is a big file, then this script will
# use a lot of memory

my $seq;
my @seq_array;
while( $seq = $seq_in->next_seq() ) {
    push(@seq_array,$seq);
}

# count elements

# @seq_array = sort { $a->length <=> $b->length } @seq_array; 

my $count = 0;
foreach my $seq ( @seq_array ) {
        $count++;
}

#dispose of array to free up resources
undef @seq_array;
return $count/2;
}

__DATA__

=head1 NAME

    calc.dsdn.pl

=head1 COPYRIGHT

   copyright (C) 2012 Mads Albertsen

   This program is free software: you can redistribute it and/or modify
   it under the terms of the GNU General Public License as published by
   the Free Software Foundation, either version 3 of the License, or
   (at your option) any later version.

   This program is distributed in the hope that it will be useful,
   but WITHOUT ANY WARRANTY; without even the implied warranty of
   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
   GNU General Public License for more details.

   You should have received a copy of the GNU General Public License
   along with this program.  If not, see <http://www.gnu.org/licenses/>.

=head1 DESCRIPTION

=head1 SYNOPSIS

script.pl  -i [-h]

 [-help -h]           Displays this basic usage information
 [-inputfile -i]      Aligned 'in frame' fasta file.  

=cut

I appreciate any help you can give, thanks very much!

dn-ds rna-seq bioperl

Sounds silly, but how large is your file? In the getpairs subroutine it says:

# loads the whole file into memory - be careful
# if this is a big file, then this script will
# use a lot of memory

Hey, the file is a little over a gig. I have however removed the getpairs sub from the actual code. He had it in the original script but its been removed.

Could you highlight then please in your code above which parts have been edited? Maybe highlight it in yellow. It would make troubleshooting a lot easier as the original script shouldn't be affected by your problem?!

Hey it's not letting me highlight more than one change but I added the

for (my $i=1;$i<=972793;$i++)

and removed a tempcalc. The for loop is a replacement for the getpairs sub. And it allowed me to grab the first two sequences as opposed to comparing one sequence against every sequence. Originally, it'd go 1 compared to 2, 3, 4, 5, 6, etc as opposed to 1 compared to 2, 3 compared to 4, 5 compared to 6 which is what I wanted. I'm sorry if this is asinine, I've just begun learning perl.

And yeah, the original script wasn't designed for such large files and it functioned slightly differently. The original script also had the memory dump problem.

1 answer

This will most likely not solve the problem, but the following line causes the script to fail due to an error.

print MYFILE "$key\t$seqlength\t",sprintf("%.2f","\t",sprintf("%.0f",$Nd{$key}),"\t",sprintf("%.0f",$Sd{$key}),"\n";

Looking at this line, it seems rather confusing and all the sprintf commands do not help to make it any easier. You seem to be missing a string/value in your very first sprintf including the bracket to close the command.

In your case, I would try and define the sprintfs prior to printing them. Maybe you want to try something like

my $FIRST_formatted = sprintf("%.2f", $YOUR_VALUE);
my $Nd_formatted = sprintf("%.0f",$Nd{$key});
my $Sd_formatted = sprintf("%.0f",$Sd{$key});
print MYFILE join "\t", $key, $seqlength, $FIRST_formatted, $Nd_formatted, $Sd_formatted;

Now, this may only make your code work and easier to read, but as said above, may not solve your problem.

One further issue is in this line

### open file specified in command line for writing (if omitted on command line, "output.txt" will be used.
open (MYFILE, '>>'.$outputfile);

It should be open (MYFILE, '>>', $outputfile) or die "Cannot append to $outputfile\n";

Great, thanks for that. It worked prior but hopefully this makes it a little cleaner. I've made the change and begun running it on the cluster for a short period of time. Any other ideas about why it could be going so slowly?

Could you add to your problem description a little sample input file? I might be able to work it out then but without data it's rather difficult to test your script.

>comp10_c0_seq1|m.51-198PID=95.96LEN=198HSP=1
ACAATCACAGATGTGCTCAATGGTAAGTTCCTGCGAACTCCCTTTACGTATGTTGACCTA
GCTGGATATTCCCTCAAGAAAAAAGCTGCTGGCAACAAGTTCCTGAATGGTCGCTTTGGG
TTAAGCGAAGTGTCAATCAAATTGCCCAAGTTCTCTGTACCTCCATGCGTGAAATGTTTT
CGTTGGCGACTCGTTCTNC
>comp12035_c0_seq5|m.150981102-1296PID=95.96LEN=198HSP=1
ACAATCACAGATGTGCTCAATGGTAAGTTCCTGCGAACTCCCTTTACGTATGTTGACCTA
GCTGGATATTCCCCCAAGAAAAAA---GCTGGCAACAAGTTCCTGAATGGTCGTTTTGGG
TTAAGCGAGGTGTCAATCAAATTGCCCAAGTTCTCTGTTACTCCATGCGTGAAATGTTTT
CGTTGGCGACTCGTTCTC

Running your script with your data gives me an error message with a not integral number of codons message. Any ideas why?

It means that there isn't a divisible by 3 sequence there, but there is. Was what you copied truncated?

Also, running the script on a small set of data doesn't really help. It works with small amounts of data. It's about making it faster. If this is for the purpose of better understanding the script, I understand though.

Okay it still does not work for me. Same error even after copying both, script and input file, again.

I know your issue, but to my knowledge I should be able to get it to run in order to see where it can be sped up without loosing it's original purpose.

The only immediate problem I could see happening is that your file is read as one and stored in your memory. Maybe you would want to try reading it line by line or alignment by alignment and handling each separately. But in order to help you with this I would need to be able to run it.

Log in to answer this question.