RNAduplex sequence input format
Hello!
I am using RNAduplex from Vienna package and trying to find out in which format the two sequences has to be passed to the cmd. The manual only say "reads two RNA sequences from stdin or <filename>". I used a filename but this might lead to IOErrors if my query sequence is very long. Does anybody know how to give the two sequences?
Thanks in advance!
• 3,444 views
•
link
1 answer
You should give two sequences with or without the headers (>seq1...)
e.g.
$RNAduplex
Input two sequences (one line each); @ to quit
....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8
AGCGAGCTGTGTGACTGTGACTGATGCTG
ACGAGCTGATGCTGATCTATGCGTATGCTGATGC
lengths = 29,34
((((.((.(((((((.(((.(....(((.&.))).).))).).)).)))))).)))). 1,29 : 3,30 (-10.00)
If your sequences are in a file you should execute:
$RNAduplex < input_file
each pair of RNA sequences will be evaluated for their binding.
• 1 views
•
link
Log in to answer this question.
Hello Asaf!
I want to start RNAduplex from a cmd in a Python script by entering the sequence directly (not a file).
I tried already but without success:
Thanks
or I can send you a script that open a process, write sequences to the process and read the results, works with threading as well if you have a lot of sequences
Sorry, Asaf I am still having problems:
In Python I do something like this:
But I want to give the raw sequences as parameters. I tried something like:
but it does not work. Any hints?
you can either have stdin=subprocess.PIPE and have: