This is a test version of Biostars. For the public version, visit https://www.biostars.org.
RNAduplex sequence input format

Hello!

I am using RNAduplex from Vienna package and trying to find out in which format the two sequences has to be passed to the cmd. The manual only say "reads two RNA sequences from stdin or <filename>". I used a filename but this might lead to IOErrors if my query sequence is very long. Does anybody know how to give the two sequences?

Thanks in advance!

rna-seq
• 3,432 views • link
updated by Ram Ram • written by ete ete

Hello Asaf!

I want to start RNAduplex from a cmd in a Python script by entering the sequence directly (not a file).

I tried already but without success:

'RNAduplex ATG GTC'
'RNAduplex ATG\nGTC'

Thanks

• 0 views • link
updated by Ram Ram • written by ete ete 
echo "AGCT\nACGT\n" | RNAduplex

or I can send you a script that open a process, write sequences to the process and read the results, works with threading as well if you have a lot of sequences

• 0 views • link
updated by Ram Ram • written by Asaf Asaf

Sorry, Asaf I am still having problems:

In Python I do something like this:

cmd = 'RNAduplex < duplex.seq'
p = subprocess.Popen(cmd,shell=True,stdout=subprocess.PIPE)

But I want to give the raw sequences as parameters. I tried something like:

cmd = "AGCT\nACGT\n" RNAduplex

but it does not work. Any hints?

• 0 views • link
updated by Ram Ram • written by ete ete 
cmd = 'echo "AGCT\nACGT\n" | RNAduplex'

you can either have stdin=subprocess.PIPE and have:

p.stdin.write("ACGACT\nACGAGCTG\n")
print p.stdout.next()
• 0 views • link
updated by Ram Ram • written by Asaf Asaf

1 answer

You should give two sequences with or without the headers (>seq1...)

e.g.

$RNAduplex

Input two sequences (one line each); @ to quit
....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8
AGCGAGCTGTGTGACTGTGACTGATGCTG
ACGAGCTGATGCTGATCTATGCGTATGCTGATGC
lengths = 29,34
((((.((.(((((((.(((.(....(((.&.))).).))).).)).)))))).)))).   1,29  :   3,30  (-10.00)

If your sequences are in a file you should execute:

$RNAduplex < input_file

each pair of RNA sequences will be evaluated for their binding.

• 1 views • link
updated by Ram Ram • written by Asaf Asaf

Log in to answer this question.

More posts like this