This is a test version of Biostars. For the public version, visit https://www.biostars.org.
what is stem loop in miRNA at miRBase data base?

Hi all,

I'm searching for the miRNAs in miRBase database. when I enter the ID of miRNA, I get following information:

Accession number    MIMAT0000062
ID                  hsa-let-7a-5p
Previous IDs        hsa-let-7a
Sequence            ugagguaguagguuguauaguu
                    Get sequence
Stem-Loop           hsa-let-7a-1 hsa-let-7a-2 hsa-let-7a-3

I want to figure out, what is the Stem-loop and is it functional inside of cell?

EDIT on 9/23/2021 by @Ram:

Removed the links from the code block above and added them here:

  1. Get sequence
  2. hsa-let-7a-1
  3. hsa-let-7a-2
  4. hsa-let-7a-3
next-gen rna-seq genome mirna
• 1,046 views • link
updated by Ram Ram • written by jack jack

Have you tried looking it up on google or pubmed? Even wikipedia describes what a stem-loop is.

• 0 views • link
written by Devon Ryan Devon Ryan

I see, it's pre-miRNA IDs. right?

• 0 views • link
updated by Ram Ram • written by jack jack

Great link, I always wondered about those names.

• 0 views • link
written by Istvan Albert Istvan Albert

@Devon Ryan, what is the relationship between expression level of miRNA precursor and mature miRNA ? becuase I just have information about the targeting of mature miRNA from TargetScan and on other hand I need the expression level of these miRNAs which I got from TCGA. but all miRNA IDs in TCGA are miRNA precursor IDs. How can I solve this problem ?

• 0 views • link
written by jack jack

0 answers

No answers yet.

Log in to answer this question.

More posts like this