This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bam-readcount reports all reference bases as N

Hi,

I'm running bam-readcount (commit 6c3f3ae901) on a few hundred bam files against a single reference fasta file (designated with -f). However, when I look at the output for any of the files, all of the reference bases, for any position, are N.

NODE_14_length_46_cov_1.239130  52      N       1       =:0:0.00:0.00:0.00:0:0:0.00:0.00:0.00:0:0.00:0.00:0.00  A:1:2.00:36.00:2.00:1:0:0.00:0.02:0.00:0:0.00:0.00:0.00 C:0:0.00:0.00:0.00:0:0:0.00:0.00:0.00:0:0.00:0.00:0.00    G:0:0.00:0.00:0.00:0:0:0.00:0.00:0.00:0:0.00:0.00:0.00  T:0:0.00:0.00:0.00:0:0:0.00:0.00:0.00:0:0.00:0.00:0.00  N:0:0.00:0.00:0.00:0:0:0.00:0.00:0.00:0:0.00:0.00:0.00

Is this a bug? The base in the reference sequence at this position is A.

>NODE_14_length_46_cov_1.239130
AGCTAACTGAGTTTATCACACTCAGTTAATGTCCATTTCACTTCACACATAACCTTACAG
ATCGGAAGATCTCGTA

Thanks!

bam-readcount

A total guess, but is there any chance the reference fasta file is wrong (i.e. not the one that was used to make the bams)? I seem to remember having a similar problem when I mixed up reference files doing similar things.

Thanks, but in this case, there's only a single reference file.

2 answers

I see this if I run on the entire BAM file without specifying a list of positions or a region. This is a bug. I pushed a very quick fix out that should solve this issue. It's 4b6479a42d002d855eda6a45bca097756d493cdb. Does this fix the issue?

Yup - reference bases are being reported now. Thanks!

The only way I was able to reproduce this type of problem was by manually changing the reference fasta in a way that invalidates the index.

Assuming you have samtools handy, what is the result of:

samtools faidx ref.fa NODE_14_length_46_cov_1.239130:50-52

where ref.fa is your reference fasta? If you get something unexpected, try removing the "ref.fa.fai" file (or whatever yours is called) and running bam-readcount again (it will be automatically recreated).

One way this could happen is if you generated the fasta, ran bam-readcount, then regenerated the fasta with different contents. The fasta index would be stale in this case.

~/data7/src/samtools/samtools faidx contigs.fa NODE_14_length_46_cov_1.239130:50-52
>NODE_14_length_46_cov_1.239130:50-52
TAA

I blew away the index and recreated it with bam-readcount (it's the same size). Still getting N for the reference base.

Log in to answer this question.