This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error With Fastx_Clipper Tool To Remove Adapter.

I am using fastx_clipper tool to remove the adapter sequence from my data file, and I run it as follows:

fastx_clipper -a AGATCGGAAGAGCACACTCTCGTATGCCGTCTTCTGCTTG -Q 33 -i input_file.fastq -o output_file.fastq

and it works for all my file except one of them which gave my the following error

fastx_clipper: Error: invalid quality score data on line 60451008 (quality_tok = "=@<DDB'8;>?B?C?CCBCCC>CC<?8?(2?</50316-?@?(++3>C99AC993+>:9><@8:(:@CC?:>:>AC:8(2:C:>(4?@@5?###"

Then I tired to use sed command to remove the last 4 lines (last read) of this file as follows:

sed '60451005,60451008 d' .fastq > new.fastq

but the output file new.fastq was too small comparing with the original file (I don't know what happened with the file format), also it was not working with fast_quality-trimmer tool . so I need some one to help me to figure out what is the problem.

fastq fastx_clipper

1 answer

This question has been asked before - for example What To Do With An Error In The Fastq Illumina Quality Scores and Fastq Quality Check

There are several solutions in these threads,

1) update your fastx toolkit
2) use the option -Q 33
3) fastx seems to be incompatible with the quality scores of some Illumina versions, in that case use FASTQC instead

Hi Philipp, I am used the above command with 7 other files and it worked well. Also, as you can see above i used -Q 33. so I think there is no problem with this version. Now I need to know to use sed correctly to remove the 4 lines. because when I checked the last line which is the quality score of the last seq I found that the seq length is 100bp, but the quality score length was 74.

Ah OK, of get rid of the last four lines you can also use head:

length=`wc -l < yourfile.fastq` # this way wc doesn't return the filename
length=`expr $length - 4`
head -n $length yourfile.fastq > fixed_file.fastq

But looking at your file again, it looks like whatever generated it crashed - did you copy it from somewhere else? Or did another program generate it and crashed while doing so?

Log in to answer this question.