This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Raw Alignment Score Calculation

Thanks for lots of answers and I've started with lots of sources here. It helps me to get a good introduction to blast.

After I've now a little more understanding I can ask more specific questions such as the following:

The following blast result:

ATTTGCAGAATTTGCAAAAAAATGTTTGT
|||||||||||||||    ||||||||||
ATTTGCAGAATTTGC----AAATGTTTGT

I'd like to calculate the raw alignment score: (Scoring scheme: match=1, mismatch= -2, opening gap= 3, extented gap=2)

We have 25 matches and 4 gaps. S = 25-9 = 16 or do I need to say: there are 4 gaps which are 4 mismatches and therefore we get the following raw score: S = 25-9-8= 8

Which one is correct?

Thanks! Beeth.

blast scoring
• 15,468 views • link
updated by Gww Gww • written by Beeth • Beeth

1 answer

In your scoring scheme you are using an affine gap penalty. Therefore your score should be:

25 - ([opening penalty] + [gap extension] * (l - 1)) = 25 - (3 + 2 * 3) = 16

Where l is the length of the gap. The mismatch score is only used when the aligned bases mismatch outside of a gap.

• 205 views • link
written by Gww Gww

Note that BLAST is bit more complicated than this, and scales match/mismatch scores by the nucleotide's frequency in the data set (i.e. if A's are more frequent in general than G's, then matching a T to an A is going to be cheaper than matching it to a a G). Isn't Karlin-Altschul also doing some adjustment for sequence lengths?

• 0 views • link
written by Ketil Ketil

Log in to answer this question.

More posts like this