Dnastringset Error Biostrings In R
Hello Biostars,
I am attempting to import a fasta file of sequences into R using Bioconductor's 'Biostrings' package and the 'DNAStringSet' function, but I keep getting the same error:
Error in .Call2("new_XString_from_CHARACTER", classname, x, start(solved_SEW), :
key 112 (char 'p') not in lookup table
My fasta file ("FileName.fa") is in the following format:
>GeneNameOne
CAGACACCCATAGATACAGATAGACAGATAGAGAAGACACCACCACACAATGA
>GeneNameTwo
CGCGACATGAACCCATGATAGACGATGAGACCCCACACACACC
...etc
Does anyone have an idea on what is going on? Thanks in advance.
• 4,278 views
•
link
0 answers
No answers yet.
Log in to answer this question.
What happens if you
grep p FileName.fa?Im assuming you mean, using the Unix terminal. Nothing happens.
Yes, I was just curious if there actually is a 'p' in the file. Apparently not. It's useful in these cases to have a small test-case that reproduces the problem. If you can make a small enough version of that file that it can be posted somewhere easily then that'd be helpful.