Dnastringset Error Biostrings In R
Hello Biostars,
I am attempting to import a fasta file of sequences into R using Bioconductor's 'Biostrings' package and the 'DNAStringSet' function, but I keep getting the same error:
Error in .Call2("new_XString_from_CHARACTER", classname, x, start(solved_SEW), :
key 112 (char 'p') not in lookup table
My fasta file ("FileName.fa") is in the following format:
>GeneNameOne
CAGACACCCATAGATACAGATAGACAGATAGAGAAGACACCACCACACAATGA
>GeneNameTwo
CGCGACATGAACCCATGATAGACGATGAGACCCCACACACACC
...etc
Does anyone have an idea on what is going on? Thanks in advance.
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Ideogram in Gviz without a valid UCSC genome
written by viniciushs.z •
-
Matching short reads to a reference sequence considering wildcards with the Biostrings package
written by vitor.aguiar •
-
Problems Installing Gkno
written by jftaylor •
-
Fasta File For Exomedepth And Cnv Calling
written by Jimbou
-
Help In Standaloneblast Bioperl
written by Bioinformatics_NewComer
-
Clustalw Ignoring Custom Weight Matrix
written by interfect •
-
Bug: Longer Pairwise Sequence Alignment In R
written by threesam •
-
How Fundamental Is The 4 Gb Size Limit For Building Burrows-Wheeler Indices
written by Owen S.
-
What Is A Good Way To Implement Getting A Consensus Sequence In Java?
written by Brandstaetter
What happens if you
grep p FileName.fa?Im assuming you mean, using the Unix terminal. Nothing happens.
Yes, I was just curious if there actually is a 'p' in the file. Apparently not. It's useful in these cases to have a small test-case that reproduces the problem. If you can make a small enough version of that file that it can be posted somewhere easily then that'd be helpful.