Hi everybody,

For a bit of context I'm blasting sequences using Bio.Blast for Bio python. The reason I'm posting today is because I came across a strange result today, After querying a sequence posted below I received the following e-value: 9.35185. This is to my understanding not usable e-value as it is superior to 1. I've linked the code used below as it may be human error. Any idea to why this might be happening would be greatly appreciated.

def query(sequence : str):
"""
:param sequence:
:return: Query_id , accession_code, description, organism,
score , e-value, identities,

"""

print(f"Querying {sequence}")

#   query NCBI database and parse out the resulting HTML file
results_handle = NCBIWWW.qblast(program="blastx", database="nr",
                                sequence=sequence)
blast_records = NCBIXML.parse(results_handle)
blast_record = next(blast_records)

#recover query identification code
query_id = blast_record.query_id

#Loop through resulting hits
for alignment in blast_record.alignments:

    #Find accession_code (2), description (3), organism from hit (4)
    name = re.search(pattern=r'(\|([.\w\d]*)\|)(.*?)(\[(.*?)\])',
                     string=alignment.title).group(2, 3, 5)
    accession_code = name[0]
    description = name[1]
    organism = name[2]
    print(name)

    #loop through HSP from alignment (n)
    for hsp in alignment.hsps:
        hit_score = hsp.score
        escore = hsp.expect
        bits = hsp.bits
        print(f'hitscore {hit_score},evalue {escore},bits {bits}')
return

sequence used: GACCTTTTGTTCCCACGCGCAGGGAGTCGCCCTGTCTCCAACTGAACAAGTTGTTCAGTTGCTTCATCCCGGTGACGTCCTAAAATGTCTGTAGAAACTTCCGCCGGGTGGCGCCTGGGCGGAAAGGAAAAGGGCCTGGCTCCTCCAAGATGGTTGGTTGGCAAAGACCCCATCGGAAGGAGACCAGACCCGTGAACAAGTCCAGTGTACCACCGAGCGAGCGTAGTGCCAAGGAGATTGAGGCGCTTTTGGATGCCGAGCGCCAGGAGGGCGAGAACCTGCTCAGCAGCTTGTTCCGCGG