Hi! I have a 10X scRNAseq data set that contains pig and human cells. I am trying to generate a hybrid human/pig reference for CellRanger as described by Cheung et al Nature Comm 2024

My approach is to download the ENSEMBL pig and human FASTA/GTF files. In order to ensure fully unique gene names, I wanted to add a prefix 'HUMAN' and 'PIG' to each. However, I am not sure where to add the prefix in both files bc their nomenclature seems to be different. For example, below, I could make it "HUMAN_ENST00000390473.1" and "HUMAN_ENSG00000142611" but I'm not sure how CellRanger could map them together.

Any ideas? Please let me know if I am misunderstanding or approaching this wrong.

 #FASTA EXAMPLE:
ENST00000390473.1 cdna chromosome:GRCh38:14:22450089:22450139:1 gene:ENSG00000211825.1 gene_biotype:TR_J_gene transcript_biotype:TR_J_gene gene_symbol:TRDJ1 description:T cell receptor delta joining 1 [Source:HGNC Symbol;Acc:HGNC:12257]
ACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAACCAA

#GTF EXAMPLE:
1       ensembl_havana  gene    3069168 3438621 .       +       .       gene_id "ENSG00000142611"; gene_version "17"; gene_name "PRDM16"; gene_source "ensembl_havana"; gene_biotype "protein_coding";