ChIP-seq reads trimming
ERROR: sequence and quality have different length:
@SRR16684719.6426858 6426858/1
CCCCTTCCTTTCTTTTTTGAGTTGGAGTTTCACTCTTGTTGCCCAGTCTGA
+
FFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
I am trimming the fastq files with fastp, and it is showing this error, the file size after trimming is also very less as compared to the raw untrimmed fastq files. How can this be corrected? I have also tried aligning the files (using bowtie2) without trimming and it shows up the same error in the alignment output.
1 answer
You can use one of the tools mentioned in this thread: is there a tool to recover corrupted fastq files
If you have a large number of fastq records getting removed then you really should be very careful. Removing a large number of sequences could make the data invalid.
Log in to answer this question.
More posts like this
-
fastp - can I trim specific adapters only?
written by liorglic
-
Trimming FASTQs
written by DKA •
-
When to merge multiple fastq files into one for RNAseq analysis?
written by lunarskye222 •
-
Empty output from UMItools dedup after fastp processing
written by c.heininger •
-
Bowtie: Mate files mapping error
written by priya.dalvi •
-
Bowtie2 error :: (ERR): bowtie2-align died with signal 6 (ABRT) (core dumped)
written by shrutidabral •
-
Why did FastQC reports get WORSE after trimming my data?
written by patrick.botros •
-
Trimming by fastp for multiple PE fastq.gz files using shell script
written by Mithil Gaikwad •
-
to run bowtie on multiple fastq file
written by Kritika
-
DiscoSNP++ pre-processing fastq files
written by tkitapci
