I have tried downloading the file again and running the alignment, it shows the same error. Also, it is for many fastq files. Is there a tool to remove such reads from fastq files?
ERROR: sequence and quality have different length:
@SRR16684719.6426858 6426858/1
CCCCTTCCTTTCTTTTTTGAGTTGGAGTTTCACTCTTGTTGCCCAGTCTGA
+
FFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
I am trimming the fastq files with fastp, and it is showing this error, the file size after trimming is also very less as compared to the raw untrimmed fastq files. How can this be corrected? I have also tried aligning the files (using bowtie2) without trimming and it shows up the same error in the alignment output.
1 answer
Looks like your data file is corrupt. Either download a new copy if you can or you will need to use something to remove these reads.
You can use one of the tools mentioned in this thread: is there a tool to recover corrupted fastq files
If you have a large number of fastq records getting removed then you really should be very careful. Removing a large number of sequences could make the data invalid.
Log in to answer this question.